Amplifications with archaeal primers were carried out under the following conditions: 20 cycles (denaturation at 94º C for 5 min, annealing at 75º C for 1 min (with a touchdown gradient of -‐0.5ºC per cycle), extension at 72º C for 1 min), preceded by steps of denaturation (5 min at 94º C, 5 min at 80º C, 1 min at 65ºC, 3 min at 72ºC and 4 min at 94ºC) and followed by 14 cycles of 1 min at 94º C, 1 min at 66º C and 3 min at 72ºC. In addition, the reaction was completed by a final extension of 10 min at 72ºC (Micaela García thesis, 2009).
3.5. Purification of PCR products
PCR products obtained were purified with Qiaquick PCR purification kit (Qiagen, cat.no 28104) and MSB® Spin PCR apace kit (Invitek, cat. nº 1020220200) according to the manufacturer’s protocol.
-‐47-‐
Table 5: Characteristics of the primers used in this study
Name Specificity Sensea and
positionb target Tm for
PCR Sequence (5´-‐3´) Reference
21F Archaea F: 7-‐26 16S rDNA TTCCGGTTGATCCTGCCGGA García-‐Martínez et al., 2000
1492R Arch-‐Bact R: 1492-‐1509 16S rDNA 55ºC
TACGGYTACCTTGTTACG Muyzer et al., 1995
344F Archaea F: 344-‐363 16S rDNA ACGGGGYGCAGCAGGCGCGA Raskin et al., 1994
915R Archaea R: 915-‐935 16S rDNA 66ºC
GTGCTCCCCCGCCAATTCCT Stalh and Amann, 1991
915F Archaea F:915-‐934 16S rDNA 60ºCc GTGCTCCCCCGCCAATTCC Stalh and Amann, 1991
Euryclus Archaea R: 24-‐26 23S rDNA 55ºC TCGCAGCTTRSCACGYCCTTC Benlloch et al., 2001
344-‐CG Archaea F: 344-‐363 16SrDNA 75-‐65ºC CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGC
CCCCGCCCGACGGGGYGCAGCAGGCGCGA Casamayor et al, 2000
GM5-‐GC Bacteria F: 341-‐357 16SrDNA 65-‐55ºC CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGC
CCCCGCCCGCCTACGGGAGGCAGCAG Muyzer et al., 1993
GM3 Bacteria F: 8–23 16S rDNA AGAGTTTGATCMTGGC Muyzer et al., 1995
GM4 Bacteria R: 1492-‐1507 16S rDNA 47 ºC
TACCTTGTTACGACTT Muyzer et al., 1995
RAPD1 Bacteria unknown 16S rDNA 55 ºC TGCGAACTGTTGGGAAGGG Sikorski et al.; 1999
RAPD2 Bacteria unknown 16S rDNA 55 ºC CGAGCTTCGCGTACCACCCC Sikorski et al.; 1999
RAPD3 Bacteria unknown 16S rDNA 55 ºC CGCTGCGGTTGCGCGCCGCC Sikorski et al.; 1999
RAPD4 Bacteria unknown 16S rDNA 55 ºC CTCAATGGCAGCGGCTATGG Sikorski et al.; 1999
-‐48-‐
Table 5: Characteristics of the primers used in this study
Name Specificity Sensea and
positionb target Tm for
PCR Sequence (5´-‐3´) Reference
RAPD5 Bacteria unknown 16S rDNA 55 ºC GTTTCGCTCGATGCGCTACC Sikorski et al.; 1999
RAPD6 Bacteria unknown 16S rDNA 55 ºC CGGCACACTG TTCCTCGACG Sikorski et al.; 1999
BOX1AR Bacteria unknown 16S rDNA 55 ºC CTACGGCAAGGCGACGCT Sikorski et al.; 1999
ERIC1R Bacteria unknown 16S rDNA 55 ºC ATGTAAGCTCCTGGGGATTCAC Sikorski et al.; 1999
ERIC2 Bacteria unknown 16S rDNA 55 ºC AAGTAAGTGACTGGGGTGAGCG Sikorski et al.; 1999
ef-‐2_634F Archaea 634-‐652 ef-‐2 TCC GCG CTB TAY AAS TGG Papke et al., 2004
ef-‐2_1147R Archaea 1126-‐1147 ef-‐2 50ºC
GTG GTC GAT GGW YTC GAA HGG Papke et al., 2004 radA_prSJS252F Archaea 252-‐284 radA ACS GAR KTS TWC GGS GAR TTC GGS KCS
GGS AA Papke et al., 2004
radA_prSJS253R Archaea 226-‐253 radA 50ºC
GTC SGG GTT SGM SAM SAC CTG GTT SGT Papke et al., 2004
secY_356F Archaea 356-‐376 secY TCT ATC AGG GVB YBC AGA AG Papke et al., 2004
secY_914R Archaea 896-‐914 secY 50ºC
CGA ACG AGK ATM AYB GGC Papke et al., 2004
atpB_409F Archaea F: 409-‐436 atpB GACATCGTCGGTGAGSCVATSAACCC Papke et al., 2004
atpB_906R Archaea R : 906-‐927 atpB 50ºC
GCCAGGTCVGTRTACATGTA Papke et al., 2004
gyrB_43F Archaea F: 43-‐59 gyrB ATCGACGAGGCGCTT This work
gyrB_1299R Archaea R:1299-‐1318 gyrB 55ºC CGGGTGTTTCTCGACGTT This work
-‐49-‐
Table 5: Characteristics of the primers used in this study Name Specificity Sensea and
positionb target Tm for
PCR Sequence (5´-‐3´) Reference
gyrB_339cF Archaea F: 339-‐358 gyrB 54ºCc TCGTCGAGCGGTTTCAGG This work
gyrB_998cR Archaea R: 998-‐1017 gyrB 48ºCc GCCCTCGAAGTGATCATG This work
eno_F Bacteroidetes F:100210-‐228 eno TCG ACG AGG CTA TCC GAC This work
eno_R Bacteroidetes R:998579-‐597 eno 60 ºC
GGC GTG CCG CTA TAC CGC This work
tuf_F Bacteroidetes F:1317810-‐825 tuf GAC CAC GGG AAG ACG This work
tuf_R Bacteroidetes R:1318933-‐948 tuf 48ºC
GTT ATC CCC CGG CAT This work
pyrG_F Bacteroidetes F:724839-‐851 pyrG CCG TGC AGA CCA AGT This work
pyrG_R Bacteroidetes R:726518-‐533 pyrG 50ºC
CAT GTC GAC CGA CGC This work
gap_F Bacteroidetes F:1512707-‐722 gap GCT TGG AAT TAA TGG This work
gap_R Bacteroidetes R:1511687-‐702 gap 48ºC
GCC GCT CCA CGA GAT This work
glyA_F Bacteroidetes F:986903-‐918 glyA CGC TCC GCA ACC AAG This work
glyA_R Bacteroidetes R:988178 glyA
48ºC
CGT ACA GCG GGT GCT This work
rpsE_F Bacteroidetes F:1328848-‐863 rpsE GGC GGA TCG AAA AGA This work
rpsE_R Bacteroidetes R:1329375-‐360 rpsE
48ºC
CCC GTT GAA CAC CTT This work
-‐50-‐
Table 5: Characteristics of the primers used in this study Name Specificity Sensea and
positionb target Tm for
PCR Sequence (5´-‐3´) Reference
rpsC_F Bacteroidetes F:1323483-‐495 rpsC CCC GTG GGC CAG AAA This work
rpsC_R Bacteroidetes R:1324153-‐168 rpsC 48ºC
GCT GGG GCG ACT CCT This work
groEL_F Bacteroidetes F:314922-‐937 groEL ACG AAG GAC GGC GTC This work
groEL_R Bacteroidetes R: 316619-‐634 groEL 50ºC GAC CTT CGT CGG GTC This work
uvrA_F Bacteroidetes F:604024-‐039 uvrA AAC CCG CGC TCG ACG This work
uvrA_R Bacteroidetes R: 601362-‐377 uvrA 54-‐56ºC
CTC CTC GGG CGT GCC This work
pgk_F Bacteroidetes F: 1511623-‐638 pgk GCT TGG AAT TAA TGG This work
pgk_R Bacteroidetes R: 1510412-‐427 pgk
48ºC
GCC GCT CCA CGA GAT This work
thrS_F Bacteroidetes F: 3458674-‐689 thrS GCA TCG ACA TCA CCC This work
thrS_R Bacteroidetes R:3460872-‐887 thrS 50ºC
GCG TCG GCT CGA ACT This work
recA_F Bacteroidetes F:1908864-‐878 recA CG CTC GAC KAC GCS This work
recA_R Bacteroidetes R:1907794-‐809 recA 52ºC
GTT YTC RCG YCC CTG This work
a F, forward; R, reverse
b Referred to Escherichia coli (for bacterial primers), Halobacterium halobium (for archaeal primers) 16S or 23S rRNA nucleotide position and S. ruber M31T genome (for Bacteroidetes).
c for sequencing
Materials and Methods
-‐51-‐
4. Whole-‐DNA analyses
4.1. Determination of G+C mol percentage
The G+C content of the strains that were isolated from nostrils was analyzed by hydrolyszing the DNA to its nucleosides and quantifiying them by high-‐performance liquid chromatography (HPLC). To determine the base composition of the DNAs, a previously reported reversed-‐phase HPLC method (Tamaoka &
Komagata, 1984; Ziemke et al., 1998) was followed with some modifications (Urdiain et al., 2008).
About 1-‐3 µg of DNA were diluted in a 10µl volume of water. Each sample was boiled for about 5 min and immediately chilled on ice. To the denature DNA mixture, 10 µl nuclease S1 (Roche) at 4 units µl-‐1 in hydrolysis buffer (33mM sodium acetate, 50mM NaCl, and 0.033mM ZnSO4, pH 4.5) were added, and the solution was incubated for 1h at 37ºC. Following the DNA hydrolysis, 12 µl alkaline phosphatase at 2 units µl-‐1 (Ammersham) in dephosphorylation buffer (0.1M Tris–HCl, pH8.1) were added to the mixture and incubated for 2h at 37ºC. Standards were prepared from commercial deoxynu-‐ cleotides (dATP, dCTP, dGTP, dCTP, PCR grade; Roche). Equimolar AT and GC mixtures at a final concentration of 1 nmol µl-‐1 for each nucleotide were used to prepare different standard G+C mole percentages (20–70%).
Standards were treated as the DNA samples, but omitting the addition of the nuclease S1 enzyme. The final hydrolysis mixtures of 60 µl were deproteinized by the addition of an equal volume of chloroform:
isoamylalcohol (24:1). After centrifugation (5 min at 16,000 g) the supernatants were collected and stored frozen until their injection in the HPLC. Nucleoside mixtures were separated by reversed-‐phase chromatography using a C-‐18 column (Aventis) in a HPLC system (Watersdetector, PDA2996), using a mobile phase of 0.1M (NH4) H2PO4 pH 4 with 5% acetonitrile (Panreac), at a flow rate of 1ml min-‐1. The chromatography was completed in 8–10min.
4.2. DNA-‐DNA hybridizations (DDH)
DDH experiments were carried out following a microtiter plate non-‐radioactive method.
4.2.1. Labelling and separation of DNA
Reference Halococcus strains DNAs were double-‐labelled using DIG-‐11-‐dUTP (Roche, cat. no. 1093088) and biotin-‐16-‐dUTP (Roche, cat. no. 1 093070) by using the nick-‐translation kit (Roche, cat. no. 976776).
The optimum ratio of the nucleotide mixture was 0.75 µl DIG-‐11-‐dUTP: 0.25 µl biotin-‐16-‐dUTP (vol: vol).
DNA (2 µg) was labelled according to the manufacturer’s recommendations (90 min). Labelled DNA was precipitated with 890 µl ethanol, 45µl of 3M sodium acetate pH 7, and 380 µl sterile Milli Q water, mixed by inverting and frozen at -‐20ºC for 30 min.
Materials and Methods
-‐52-‐
Then, labeled DNA was centrifuged for 15 min at 16.000 g, supernatant was discharged and the dry pellet was resuspended in 200 µl sterile Milli Q water. Two microlitres of the suspension were diluted in 800 µl PBS, and 400 µl of the dilution were mixed with 400 µl PBS. Finally, 200 µl of each of the two dilutions were used to measure the labbeling efficiency following the microtitre detection protocol mentioned below. DDH experiments were performed using a modification of the Lind and Ursing method (Rocap et al., 2003). Unlabelled DNAs from nostrils isolated strains were first diluted to a concentration of 0.3 µg ml-‐1. Target DNAs were simultaneously prepared with the same spectrophotometer in order to standardize working concentrations, and avoid biases due to concentration measurement techniques. Any single DDH set contained at least one homologous reaction, in addition to all the different mixtures to be assayed. Fifteen micrograms of unlabelled DNA were mixed in a 0.2 µl reaction cap with 100–150 ng of labeled DNA (between 10 and 15 µl depending on the labelling efficiency), and filled to 72 µl with sterile milliQ water. The mixed solution was denatured by boiling for 5 min and immediately chilled on ice. After a short spin of the DNA mixture, 28 µl of 1M phosphate buffer (PB; decreasing the pH of a 1M Na2HPO4 solution with 1M NaH2PO4 to pH 6.9) were added and mixed by vortexing. The 100 µl hybridization mixtures were covered with 50 µl of light mineral oil (Sigma) in order to avoid evaporation and volume changes during incubation.
Finally, all the solutions were incubated for 16h at 30ºC (non-‐restrictive), below the melting point temperature (Tm) of the homologous DNA in 0.28M PB (Rosselló-‐Móra, 2006). The Tm of each homologous DNA was calculated from its G+C mole content [Tm=(G+C+182.2)/ 2.44], in this case considering a G+C content of 61% mol content for all strains and resulting in 69ºC. Single-‐ and double-‐
stranded DNA were eluted on hydroxyapatite (HA) following the scaled batch procedure previously reported (Ziemke et al., 1998).
Prior to chain separation, HA (DNA grade Bio-‐Gel HTP, Bio-‐Rad) was equilibrated with 0.14M PB as follows: 1g HA was mixed with 10ml PB and vigorously shaken. Aliquots of 200 µl (two for each single mixture with about 20mg HA dry weight) were transferred to 1.5ml microtubes and centrifuged for 1 min at 13,000g. Clear supernatant was removed, and the wet HA was stored for chain separation. Each DDH mixture was diluted with sterile Milli Q water to a final volume of 0.2ml, with a final PB ion strength of 0.14M. Two 50 µl aliquots of each single DDH mixture were transferred to two microtubes containing equilibrated HA, respectively. Transfer was carried out carefully in order to avoid introducing mineral oil that had been previously wiped from the pipette tip with a clean tissue. The DDH solution was well mixed with the HA and incubated for 15 min at 35 ºC below the association temperature (64.8 ºC).
Materials and Methods
-‐53-‐
During incubation, double-‐stranded DNA was bound to HA but, to optimize the procedure, the suspensions were mixed repeatedly, since the HA tended to sediment out very quickly. After incubation, 450 µl of PB (0.14M, 0.2%SDS) were added to each tube, mixed thoroughly and incubated with repeated mixing for 5min at the same temperature. Single stranded DNA remained unbound in the supernatant, and was collected after centrifugation (2 min at 13,000g) and stored in a clean tube. The HA pellet was once more washed with 500 µl PB (0.14M, 0.2% SDS) at the same temperature and for the same time.
After centrifugation, the 500 ml of supernatant were added to that previously recovered. The total quantity of supernatant harbouring single stranded DNA (SS) was 1 ml.
The HA pellet containing bound double-‐stranded DNA was well mixed with 200 µl 0.4M PB, and kept at room temperature for 1–2 min. Supernatant was collected after centrifugation (2 min at 13,000 g), and the pellet was washed again with 200 µl 0.4M PB. The final volume of double-‐stranded DNA (DS) was 400 µl. These samples were denatured by boiling, and they were ice chilled prior to their detection on microtitre plates.
4.2.2. Detection of eluted DNA
Each single DDH mixture was eluted in two independent HA treatments. Single stranded DNA (1 ml) was amended with 10 µl of bovine serum albumin (BSA, 10% in 1X PBS), and double-‐stranded DNA (0.4 ml) was amended with 4 µl of 10% BSA. From each single elute, 200 µl were transferred to a well of a streptavidin coated microtitre plate (Roche), and incubated for 2h at room temperature with vigorous shaking. Unbound DNA was then discarded and the wells were thoroughly washed at least three times with 1X PBS. In each well, 200 µl of the antibody mixture (anti-‐digoxygenin AP, Roche; 1:5000 in 1X PBS, 1% BSA) were added and incubated for 1h at room temperature with vigorous shaking. Wells were then thoroughly washed at least three times with 1X PBS.
Finally, 250 µl of developing solution (7.5Mm Na2CO3, 15.5mM NaHCO3, 1mM MgCl2 x 6H2O, pH 9.6) with 1 mg ml-‐1 p-‐nitrophenyl phosphate (Sigma) were added to each well. The microtitre plate was incubated at 37ºC, without agitation, and colour development was measured at 405nm (Tijssen, 1985) in an absorbance plate reader (Sunrise, Tecan).
4.2.3. Treatment of hybridization data
Homologous and heterologous reassociations were processed simultaneously. The degree of reassociation (binding ratio) was expressed as the percentage of labeled DNA released with 0.4M PB (DS) compared to the total labeled DNA released (DS+SS) (BR= DS x 2 / (SS x 5 + DS x 2) x 100).
Materials and Methods
-‐54-‐
The relative binding ratio (RBR) of heterologous DNA was expressed as the percentage of the homologous binding calculated for the control DNA (RBR= BRheteroduplex / BR homoduplex x 100).
Finally, for each experiment, the pooled standard deviation was calculated as √Σ (X-‐x) 2/n (where X is the mean of the RBR values, x each single value, and n the number of single values obtained.
5. Sequencing of genes and phylogenetic reconstructions
5.1. Sequencing
Sequencing of the complete or partial genes analyzed in this work was made in technical scientific services of University and by private DNA Sequencing Services (Genomex in France, Secugen in Spain). In all cases, the nucleotide sequences were determined using the Big Dye Terminator Cycle Sequencing kit (Applied Biosystems) according to manufacturer’s recommendations and an ABIPRISM 310 DNA sequencer (Applied Biosystems).
5.2. Sequence analyses
Sequences were revised and corrected with Sequencher v 4.7 (Gene Codes Corp.). 16S rRNA gene alignments were produced with the use of the ARB software package (Ludwig et al., 2004) (www.arb-‐
home.de), introducing the new almost complete sequences into a preexisting alignment available of about 208,000 single sequences (Pruesse et al., 2007) (www.arb-‐silva.de).
Housekeeping gene sequences for multilocus sequence analysis (MLSA) were aligned with the use of the program ClustalX 1.83, and the alignments were improved by removing hypervariable positions with the use of the online available program Gblocks (http://molevol.ibmb. csic.es/Gblocks_server.html) using the conditions previously published (Soria-‐Carrasco et al., 2007).
5.3. Phylogenetic reconstructions of 16S rRNA gene and concatenated genes
Phylogenetic reconstructions based on DNA sequence data were performed using the neighbor joining, maximum likelihood, and maximum parsimony algorithms as implemented in the ARB software package (Ludwig et al., 2004), or online (http://atgc.lirmm.fr/phyml/) by the use of the PHYML program package (Guindon & Gascuel, 2003). Topologies and branch lengths were optimized by the both programs.
Reference sequences of 16S rRNA gene were retrieved from the SILVA database (Pruesse et al., 2007).
Materials and Methods
-‐55-‐
Type strain information and reference alignment was extracted from the All-‐Species Living Tree release 93 (Yarza et al., 2008). Alignments were performed using SINA (Pruesse et al., 2007) implemented in the ARB package (Ludwig et al., 2004) and manually improved using the secondary structure ARB-‐editor by following the reference alignment of the Living Tree Project. Multiple analyses were carry out to find topology changes due to the effect of the gene composition of the alignments and to evaluate tree topology stabilities, as previously recommended (Ludwig & Klenk, 2001). Bootstrap values were obtained after the calculation of 100 replicates, as implemented in the PHYML program package.
All analyses to coding.protein genes were performed by using the nucleotide sequence alignments, since their translation into amino acids rendered a very small number of informative positions. Using PHYML program package, all alignments were calculated by using the HKY substitution model (Hasegawa et al., 1985), and the proportion of invariable sites and the transition/transversion rates were estimated. The number of substitution rate categories was 4. Calculations were performed by using a BIONJ starting tree (Guindon & Gascuel, 2003).
6. Protein extraction and quantification
6.1. Outer membrane protein extraction
Membrane fractions were prepared as previously described (Bucarey et al., 2006; Lobos & Mora, 1991).
Briefly, bacteria were grown under optimal conditions (37ºC with shaking at 125 rpm) to mid exponential phase. Then, 2 or 4 ml of culture were taken, chilled on ice, pelleted by centrifugation at 16.000 g x for 10 min at 4°C. Supernatant was discarded and pellet was resuspended in 1 ml of lysis buffer (10 mM Tris–HCl pH 8), sonicated on ice for 100 seconds (60%, 30 power, 10 pulses), and then supplemented with 30 µl of Pefabloc (69.5mM, Roche, cat. no 11429876001). Whole cells and debris were removed by low-‐speed centrifugation (4500g, 5 min), pellet was discarded and supernatant was recovered in a new tube. Total external membrane fractions were obtained after 30 min of centrifugation at 16.000 g at 4°C. Supernatant was discarded and pellet resuspended in 500 µl of fresh solubilization buffer (10 mM Tris–HCl pH 8, 10 mM MgCl2, 2% triton X-‐100 or Nonidet 40). Mixture was incubated for 30 min at 37ºC, shaking occasionally.
Materials and Methods
-‐56-‐
Inner membrane proteins were solubilized with 2% triton X-‐100 or Nonidet 40, and the outer membrane fraction was pelleted by centrifugation at 16.000 g for 30 min at 4ºC, and solubilized in 30 µl of 100 mM Tris–HCl pH 8, 2% SDS buffer, while supernatants were recovered in a new tube for inner membrane protein extraction (see bellow). Outer membrane protein extracts were boiled during 5 min and maintained at -‐20ºC until use.
6.2. Inner membrane protein extraction
Supernatants recovered from outer membrane proteins protocol (Bucarey et al., 2006; Lobos & Mora, 1991), containing the proteins associated with the inner membrane were precipitated by the addition of 2 volumes of cold acetone and centrifuged at 16.000 g for 10 min at 4ºC. Pellets were air dried and resuspended in 30 µl of Tris–HCl 100 mM, pH 8 buffer, 2% SDS, then boiled during 5 min and maintained at -‐20ºC until use.
6.3. Protein quantification
Based on the method described by Bradford (Bradford, 1976), outer and inner proteins were quantified by using Bio-‐Rad Protein Assay (cat no. 500-‐0006). Dye reagent was diluted 1:4 times in distilled water and filtered through Whatman filter (celullose, no.1, grade >11 µm) to remove all possible reagent particles.
Five dilutions of Bovine Serum Albumin (BSA) (0.5 mg ml-‐1, Sigma) were prepared to elaborate the calibration curve, whose concentrations ranging from 0 to 75 µg ml-‐1 (Table 6). Samples and standards were prepared in 0.15M of NaCl (final volume of 200 µl). After the addition of 2ml of diluted dye reagent, samples were vigorously mixed and incubated at room temperature for at least 5 min.
Standards were measured in duplicate at 595 nm in a Hitachi U 2900 spectrophotometer.
Proteins samples were prepared by mixing 8 µl of the extract with 192 µl of 0.15 M NaCl and treated in the same way as standards. A linear regression absorbance/ concentration was calculated and the exact concentrations of the unknown samples were determined by interpolation considering the dilution factor of the samples. Five microliters of loading buffer were added to aliquots containing 20 µg of protein (30 µl as final volume) and, as indicated above, boiled during 5 min and maintained at -‐20ºC until use.
Materials and Methods
6.4. Matrix Assisted Laser Desorption/Ionization-‐ time of flight Mass Spectrometry (MALDI-‐TOF MS) Cultures (1.5 ml) were pelleted at 16.000 g for 3 min and resuspended in 500μl 70 % ethanol. The
Materials and Methods
-‐58-‐
6.4.1. Mass spectra analyses
All mass spectra profiles were grouped in a matrix and evaluated by Hierarchical clustering using the software PRIMER-‐E ® (Plymouth). Based on the presence and absent of signals, a dendrogram of the mass spectra was obtained by single linkage agglomerate similarity calculations. In addition, the data were analyzed in SIMCA-‐P 11.5 (Umetrics, Umea, Sweden). Supervised partial least square discriminative analysis (PLS-‐DA) applying the orthogonal signal correction (OSC) was used in order to evaluate the dependence of signals with the time and stress conditions (Sjöström et al., 1986; Stahle & Wold, 1987).
7. Lipopolysaccharide (LPS) analysis
7.1. LPS extraction
LPS was prepared by following two different methods: the first is a modification of the method described by Hitchcock (Hitchcock & Brown, 1983), in which exponential cultures of M8 and M31 strains of S. ruber were harvested by centrifugation and pellets were resuspended in water until reaching a
DO420 nm= 0.4. Suspensions (1.5 ml) were centrifuged at 16.000 g for 10 minutes, supernatants were
discarded and pellets resuspended in 50 µl of lysis buffer (2% SDS, 4% β-‐mercaptoethanol, 10% glycerol, 1M Tris pH 6.8, 0.02% bromophenol-‐blue) and boiled for 5 min. After adding 5 µl of proteinase K (5 mg ml-‐1 in water solution, Roche), samples were incubated for 1 hr at 60 ºC. Finally, 20 µl of solution were loaded in a 12% polyacrylamide gel (see below).
In the second method, proposed by Busse (Busse et al., 1989), 2 ml of exponential cultures of M8 and M31 strains were harvested by centrifugation at 16.000 g for 10 min at 4°C and bacterial pellet was frozen and lyophilized. Freeze-‐dried cultures were resuspended in 700 µl of lysis buffer (0.5M Tris pH 6.8, 2%SDS, 10% glycerol, 0.02% bromophenol-‐blue). Samples were mixed and boiled for 5 min. When samples were cold, 10 µl of proteinase K (5 mg ml-‐1 in water solution, Roche) were added and incubated for 1 h at 65 ºC. Finally samples were boiled for 5 min to inactivate proteinase K. Samples were centrifuged at 9.300 g for 10 min, and 20 µl of supernatant-‐solution were loaded in a 12%
polyacrylamide gel (see below).
Materials and Methods
-‐59-‐
7.2. Detection of LPS by silver staining
To check the LPS composition, extracts were subjected to the polyacrylamide gel electrophoresis (Laemmli 1970). It included a 5% stacking gel and a 12% separating gel. Tris-‐glycine buffer (pH 8.3) was used as electrode buffer. The electrophoresis was carried out as indicated in seccion 8.2.
Lipopolysaccharides extracts (20 µl) were loaded into the gel and the electrophoresis was performed at 70 V during 1 hr and then 100 V, until the dye front reached the bottom of the gel (about 2 h). After electrophoresis, silver staining was carried out according to Tsai and Frasch (Tsai & Frasch, 1982). The gel was kept overnight in a fixative solution containing 40% ethanol and 5% acetic acid in a clean plastic box. Next, the fixative solution was replaced by 0.7% periodic acid in 40% ethanol and 5% acetic acid to oxidize the LPS during 5 min. Subsequently, three washes of 15 min were performed using double distilled water. Finally, the gel was immersed in fresh staining reagent (150 ml) for 30 min. The staining reagent was prepared as follows: 4 ml of concentrated ammonium and 28 ml of 0.1 N sodium hydroxide were added to 115 ml of double distilled water and 5 ml silver nitrate (1g dissolved in 5 ml of MiliQ water). The concentrated ammonium was added drop by drop with magnetic stirring. Transient brown precipitate was formed when each drop of silver nitrate solution was added, but it disappeared within
Lipopolysaccharides extracts (20 µl) were loaded into the gel and the electrophoresis was performed at 70 V during 1 hr and then 100 V, until the dye front reached the bottom of the gel (about 2 h). After electrophoresis, silver staining was carried out according to Tsai and Frasch (Tsai & Frasch, 1982). The gel was kept overnight in a fixative solution containing 40% ethanol and 5% acetic acid in a clean plastic box. Next, the fixative solution was replaced by 0.7% periodic acid in 40% ethanol and 5% acetic acid to oxidize the LPS during 5 min. Subsequently, three washes of 15 min were performed using double distilled water. Finally, the gel was immersed in fresh staining reagent (150 ml) for 30 min. The staining reagent was prepared as follows: 4 ml of concentrated ammonium and 28 ml of 0.1 N sodium hydroxide were added to 115 ml of double distilled water and 5 ml silver nitrate (1g dissolved in 5 ml of MiliQ water). The concentrated ammonium was added drop by drop with magnetic stirring. Transient brown precipitate was formed when each drop of silver nitrate solution was added, but it disappeared within