Collection of data and information in Balearic Islands on biology of vectors and potential vectors of Xylella fastidiosa (GP/EFSA/ALPHA/017/01)

(1)

EXTERNAL SCIENTIFIC REPORT

APPROVED: 12 October 2021 doi:10.2903/sp.efsa.2021.EN-6925

Collection of data and information in Balearic Islands on biology of vectors and potential vectors of Xylella fastidiosa

(GP/EFSA/ALPHA/017/01)

López-Mercadal, J.¹, Delgado, S. ¹, Mercadal, P. ¹,

Seguí, G.

²

, Lalucat, J.

²

, Busquets, A.

²

, Gomila, M.

²

,

Lester, K.³, Kenyon, D.M.³, Ruiz-Pérez, M.⁴, Paredes- Esquivel, C.¹, Miranda,

M. A¹.

1Applied Zoology and Animal Conservation Research Group. University of the Balearic Islands. Spain

2 Microbiology (Biology Department). University of the Balearic Islands. Spain

3Diagnostics, Wildlife & Molecular Biology. Science and Advice for Scottish Agriculture. Scotland.

4GIS & Remote Sensing Service. University of the Balearic Islands

Abstract

The pathogenic bacteria Xylella fastidiosa (Proteobacteria: Xanthomonadaceae) was detected in the Balearic Islands in October 2016. In November 2017 EFSA granted the data collection on the biology of vectors in the Balearic Islands. The grant included the following objectives: i) Data collection in the Balearic Islands by macrocosm and microcosm observations of the vectors in the major agroecosystems;

ii) Proposal on field sampling protocols of vectors; iii) Identification of the major vectors of X. fastidiosa in the Balearic Islands. For the study of macrocosm, samplings were conducted in Majorca, Ibiza, Formentera and Minorca. For the microcosm study, cages containing one male and one female of P.

spumarius and one plant per cage were placed at semi-field conditions. For the development of the guidelines, literature research was conducted. For the vector competence experiments, field collected insects were caged with X. fastidiosa free plants of Medicago sativa. From the macrocosm results, two Aphrophoridae (Hemiptera; Cicadomorpha) species of vectors have been detected in the Balearic Islands, Philaenus spumarius and Neophilaenus campestris. Nymphs of Aphrophoridae were more abundant from early March to the end of May in the cover vegetation of olive crops, followed by vineyard and almond ones. Adults of Aphrophoridae were more abundant in the cover vegetation from May to June and from October to November, in the tree canopy from June to August and in the border vegetation from August to October. The microcosm trials showed that P. spumarius and N. campestris were able to develop in Lavandula dentata, Rosmarinus officinalis, Menta x piperita, Pistacia lentiscus and Ocinum basilicum. The average prevalence of X. fastidiosa from vectors collected from 2017 to 2020 was 23 %. Adults of P. spumarius and N. campestris collected from infected areas of Majorca successfully transmitted X. fastidiosa to uninfected plants of M. sativa.

(2)

Vectors and potential vectors of Xylella fastidiosa in Balearic Islands

Key words: vectors, Xylella, Balearic Islands, biology, bioecology, Hemiptera Question number: EFSA-Q-2021-00581

Correspondence: [email protected]

Disclaimer: The present document has been produced and adopted by the bodies identified above as author(s). In accordance with Article 36 of Regulation (EC) No 178/2002, this task has been carried out exclusively by the author(s) in the context of a grant agreement between the European Food Safety Authority and the author(s). The present document is published complying with the transparency principle to which the Authority is subject. It cannot be considered as an output adopted by the Authority. The European Food Safety Authority reserves its rights, view and position as regards the issues addressed and the conclusions reached in the present document, without prejudice to the rights of the authors.

Acknowledgements: the authors wish to thank Dr. Giuseppe Stancanelli and Dr. Ewelina Czwienczek (EFSA) for the great support provided during the grant. The authors wish also to thank Maria Antonia Tugores for technical support during the first year of the project; Dr. Domenico Bosco (DISAFA – Entomologia) for the support during the design and development of the grant and for his comments on Task 3; Dr. Jean-Claude Grégoire (Université libre de Bruxelles) for his comments on Task 3 and to Dr.

A. Fereres (ICA-CSIC) for his contributions in different meetings of the grant. Also thanks to Joan Bauzà Llinàs (University of the Balearic Islands) for his technical support in the GIS analysis.

Suggested citation: López-Mercadal J, Delgado S, Mercadal, P, Seguí G, Lalucat J, Busquets, A, Gomila M, Lester, K, Kenyon DM, Ruiz-Pérez, M, Paredes- Esquivel C, Miranda MA, 2021. Collection of data and information in Balearic Islands on biology of vectors and potential vectors of Xylella fastidiosa (GP/EFSA/ALPHA/017/01). EFSA supporting publication 2021: EN-6925. 136 pp. doi:10.2903/sp.efsa.

ISSN: 2397-8325

Reproduction of the images listed below is prohibited and permission must be sought directly from the copyright holder:

Figures: 1-98 ©UIB 2021.EN-6925.

(3)

Summary

Xylella fastidiosa (Wells et al. 1987) (Proteobacteria: Xanthomonadaceae) is a gram-negative bacterium pathogen of plants limited to the xylem and capable of infecting more than 600 plant species. The bacterium invades the xylematic vessels of the plant causing several types of diseases in different crops (e.g.: Pierce's disease, citrus variegated chlorosis, leaf scorch) or even the death of the plant. The bacterium is transmitted by xylem feeder insects, in particular those of the Order Hemiptera, Suborder Cicadomorpha. In Europe, the family Aphrophoridae (known as “spittlebugs”) appears to be the one of major importance for the transmission of the pathogen. Outbreaks of X. fastidiosa have been detected in Italy (2013), Corsica and mainland France (2015), Spain (2016) and Portugal (2019). In fact, the first outbreak detected in Spain was in Majorca (Balearic Islands) in October 2016 and subsequently in Minorca and Ibiza. The subspecies detected in the Balearics included X. fastidiosa subspecies: fastidiosa, multiplex and pauca. Due to situation in the Balearics and the lack of data on the potential vectors, in November 2017 EFSA launched a grant for the collection of data and information in the Balearic Islands on the biology of vectors and potential vectors of the bacteria Xylella fastidiosa. The grant included four major tasks: Task 1. Data collection in the Balearic Islands by macrocosm field observations on the biology, ecology, life cycle and abundance of Philaenus spumarius and other potential vectors in the Balearic Islands agroecosystems; Task 2. Data collection in the Balearic Islands by microcosm observations on the biology, ecology, life cycle and abundance of Philaenus spumarius and other potential vectors in the Balearic Islands; Task 3. Proposal on sampling protocols to be applied in field studies, including its fitness to Balearic Islands agroecosystems and its level of alignment/harmonisation;

Task 4. Identification of the major vectors of X. fastidiosa in the Balearic Islands by field studies and transmission assays under controlled condition. For Task 1, nine organic farms (three olive, three vineyards and three almond farms) were selected in Majorca for conducting annual monitoring. The islands of Minorca, Ibiza and Formentera were sampled twice a year, in summer and autumn. Insects were collected biweekly in each plot in Majorca by using a sweep net for adults and a wood frame of 0.25 m² for nymphs. In the other islands of the Balearic archipelago, only adults were collected since nymphs were not present at the time of the sampling. For Task 2, 50 cages containing one male and one female of P. spumarius, one plant per cage and substrate for oviposition (straw) were placed at semi-field conditions. The plants species were the following Rosmarinus officinalis, Mentha sativa/

Mentha x piperita, Ocimum basilicum, Pistacia lentiscus and Lavandula officinalis / Lavandula dentata. Insects (males and females) were placed inside the cages from September to November. For Task 3, an extensive literature review was conducted in order to identify the most frequent methods used for sampling vectors of X. fastidiosa, and in particular, those used for the family Aphrophoridae. A proposal of guideline for sampling the family Aphrophoridae in the most common crops in the Balearics, almond, olive and vineyard crops, is included in the report. For Task 4, the prevalence of X. fastidiosa positive adults was determined by qPCR in dissected heads. For the vector competence studies, field collected insects were caged with X. fastidiosa free plants of Medicago sativa for 96 h. After that period insects were analysed by qPCR for the detection of X. fastidiosa. Samples taken from plants were analysed 15, 30, 45 and 60d post inoculation.

(4)

in March- early April, while N4 and N5 were more frequent in late April- May. In the case of N.

campestris, the highest abundance of nymphs was detected in olive and almond crops. In general, nymphs of N. campestris were present from the 1^st- 2^nd week of March to the 4^th week of April in vineyard and olive crops, while nymphs seem to be absent earlier (3^rd week of April) in the almond crop.

The youngest nymphs (N2) of N. campestris were found from early March to early April, while N4 and N5 were found mainly in late April. In general nymphs of P. spumarius were more abundant in the upper- middle part of the plant, while N. campestris were more abundant in the bottom part. In regards to host- plant preference, nymphs of P. spumarius were found in a wide variety of species of plants, mainly from the family Asteraceae (i.e. Glebionis

spp. and Sonchus spp.), while nymphs of N. campestris were found exclusively in Poaceae species.

The general pattern of seasonality of adults P. spumarius recorded in Majorca showed differences according to the Secondary Sampling Unit (SSU) (herbaceous cover, tree, shrubs species surrounding the crop- border vegetation). The highest abundance of adults was recorded in May and October in the cover vegetation. Presence of adults increased in trees in June, while presence in the border vegetation of the crop increased in August and decreased around October. In the case of N. campestris, the highest abundance of adults was detected in the cover plants in May and November, however its presence in trees and border vegetation can be considered negligible.

In the case of the seasonality per crops, the seasonal pattern of adults of P. spumarius in the cover vegetation was similar in all crops with a peak of adults in May and a second one between October- November. Adults showed less abundance in the cover vegetation of almond crop compared to olive and vineyard crops. However, abundance of adults was higher in olive and almond trees compared to vineyard plants, where presence of adults was anecdotal in terms of abundance. The seasonality of adults in the border vegetation was unclear depending on the year. In general, they are present from July to November. The seasonal pattern for N. campestris was similar to P. spumarius, but the former species appeared to be less abundant in all crops.

From the sampling conducted in summer and autumn in Ibiza, P. spumarius adults were more abundant in the border vegetation of all crops, while in November they were more abundant in the cover vegetation. Adults were sporadically detected in olive trees and vineyard plants. N. campestris was more abundant in the cover vegetation of almond and vineyard but in low numbers. In Formentera, adults of P. spumarius were detected only in olive trees.

In Minorca, adults of P. spumarius were collected from olive trees and vineyard in summer, meanwhile in autumn, adults were only collected from cover vegetation. Adults of N. campestris were found in very low abundance in vineyard in summer and in autumn in the cover vegetation of almond crops.

Results on the DNA- barcoding analysis of the vectors (340 P. spumarius and 139 N. campestris) showed that both species are clustered in well supported monophyletic clades and its identification is therefore confirmed both morphologically and molecularly.

Results from microcosm trials with P. spumarius and N. campestris showed that eggs were detected only in P. spumarius cages, but nymph development was observed in the five plant species tested for both species of vectors. Philaenus spumarius showed better nymphal development in Rosmarinus officinalis and Lavandula dentata plant species, while N. campestris confirmed to develop almost exclusively in Gramineae plants.

(5)

The average prevalence of X. fastidiosa from the insects collected from 2017 to 2020 was 23 %, P.

spumarius showed a prevalence of 23.8 % and N. campestris of 21.3 %. The island with the highest prevalence was Majorca reaching the 24 %, followed by Minorca (21.5 %) and Ibiza (21 %), Formentera remained free of X. fastidiosa. From the three years of continuous sampling of vectors in Majorca, 2018 showed the highest prevalence between April and June, while in 2019 and 2020, the highest prevalence was detected from July to November.

The transmission test showed that from the 389 vectors collected from the field for the trials, the 11.32

% of them were positive to X. fastidiosa. Inoculation to plants (M. sativa) of X. fastidiosa by field collected insects was confirmed since the plants were positive by qPCR 15, 30, 45 and 60 days after inoculation. In this case, it was confirmed that field collected adults of P. spumarius and N. campestris were able to effectively inoculate the bacteria to uninfected plants that became positive to X. fastidiosa.

(6)

1. Introduction

1.0. Background and Terms of Reference as provided by the requestor

Xylella fastidiosa (Wells et al. 1987) (Proteobacteria: Xanthomonadaceae) is a gram-negative bacterium pathogen of plants limited to the xylem and capable of infecting more than 600 plant species (EFSA 2015, 2018, 2020). It is an obligatory declaration pathogen within the European Union (Decision 2015/789 / EU) and it has a specific contingency plan at national level in Spain (MAGRAMA 2015).

Worldwide, six different subspecies of X. fastidiosa have been described (Schaad et al. 2004; Schuenzel et al. 2005), but only spp. fastidiosa and multiplex are the ones recognized by the International Society of Plant Pathology Committee on the Taxonomy of Plant Pathogenic Bacteria (ISPP-CTPPB) (EFSA 2018).

The bacterium invades the xylem vessels of the plant where it multiplies and develops into a biofilm that in the course of time blocks the vessels and can cause leaf scorch, dieback of branches up to the death of the plant. The symptoms, which are mainly related to the occlusion of the xylem vessels, are frequently not specific and can be confused with mineral deficiencies or effects caused by drought (EPPO 2017). Main symptoms include rapid drying of leaf margins, showing scorched leaves (EFSA 2018).

The bacteria are the cause of important diseases in crops such as Pierce's disease in vineyards, citrus variegated chlorosis and leaf scorch in different species of Prunus sp. (Janse and Obradovic 2010). The natural transmission of the bacterium is via insects that feed in the xylem of plants; mainly by species of the Order Hemiptera, suborder Cicadomorpha and in particular three superfamilies: Cercopoidea, Cicadoidea and Membracoidea (Redak et al. 2004). Vectors in regions such as the US and Brazil include neartic and neotropical species of the family Cicadellidae (Redak et al. 2004), while the family Aphrophoridae appear to have greater relevance in Europe (EFSA PLH Panel 2015). There is no latency period from acquisition of the bacterium to inoculation (Almeida and Purcell 2006) and it appears that specific X. fastidiosa surface proteins play a role in its adherence to the vector foregut by binding to chitin-like polysaccharides lining the cuticle (Killiny and Almeida 2009).

Italy was the first country in Europe where X. fastidiosa was extensively detected in olive trees in October 2013 (Cariddi et al. 2014; Saponari et al. 2014; Loconsole et al. 2016) associated with the CoDIRO (Complesso del Disseccamento Rapido dell’Olivo) syndrome, now more correctly named Olive Quick Decline Syndrome (OQDS) (Saponari et al. 2014; Martelli et al. 2016). Subsequently, since summer 2015, several other outbreaks of X. fastidiosa belonging to other subspecies (eg: multiplex) were detected in Corsica and continental France (Provence Alpes Cotes d’Azur region) (EFSA 2021).

Recent outbreaks were located in the region of Tuscany (Italy) and Porto (Portugal) (EFSA PLH Panel 2019; EFSA 2021).

In October 2016, X. fastidiosa was detected in Majorca (Balearic Islands, Spain) (Olmo et al. 2017). In June 2017, X. fastidiosa subsp. multiplex (ST6) was detected in the Alicante region (Valencia, Spain) infecting almond trees (Generalitat Valenciana 2017) and the same subspecies and ST were also detected in April 2018 in an olive tree in the Autonomous Region of Madrid (EFSA 2021). Detections were not only in crops, in 2011 X. fastidiosa was found in coffee plants from a French garden centre and, since 2016 there were some positives in greenhouses located in Holland, Germany and Portugal (EFSA 2018 and 2021).

After the detection of a X. fastidiosa outbreak, identification, detection and surveillance of the vectors is of great importance in order to understand the epidemiology of the disease in each affected area.

In Europe, Philaenus spumarius (Linnaeus, 1758), Philaenus italosignus (Drosopoulos and Remane, 2000)and Neophilaenus campestris (Fallén, 1805) (Aphrophoridae) are the only vector species identified to date in Italy based on vector acquisition trials (Saponari et al. 2014; Cornara et al. 2016). Other species, such as Euscelis lineolatus (Brullé, 1832) (Cicadellidae) have tested positive for X. fastidiosa by PCR in Italy, however, their vector role has not been demonstrated yet (Elbeaino et al. 2014). In Corsica (Cruaud et al. 2018) an extensive surveillance of potential vectors also found P. spumarius tested

(9)

demonstrated to be present in olive groves and other host plants (Lopes et al. 2014; Miranda et al.

2017; Morente et al. 2017; Moralejo et al. 2019).

In regard to the general life cycle of the vector (Fig. 1) (Cornara et al. 2018), P. spumarius eggs hatch at the end of February/March. Nymphs develop until May throughout five nymphal stages and adults start to emerge since end April and early May. During May and June cover vegetation desiccates, and adult spittlebugs disperse to trees and shrubs. They remain in there until October/November, when ground vegetation appears again. Then, they mate and lay eggs in dried grass (EFSA 2018). P.

spumarius is an univoltine species.

Figure 1: Life cycle of P. spumarius. © J. López-Mercadal.

Sampling methods for vectors (both nymphs and adults) are important for understanding the epidemiology of the vector- borne diseases in a particular area in relation to the distribution, abundance, and phenology of the vector. Despite the current importance of the vectors of X. fastidiosa, little information is available about the standardisation of sampling methods, in particular when referring to the European scenario. Spittlebugs are an ubiquitous highly mobile group of insects, in general without major economic importance before the incursion of X. fastidiosa in Europe. Therefore, sampling methods for Aphrophoridae are those mostly used in general entomology, meaning no specific traps or attractants are available for targeted sampling.

This contract/grant was awarded by EFSA to: Dr. Miguel Ángel Miranda Chueca. University of the Balearic Islands (UIB)

Contractor/Beneficiary: University of the Balearic Islands

Grant title: Collection of data and information in Balearic Islands on biology of vectors and potential vectors of Xylella fastidiosa

(10)

Task 1. Data collection in the Balearic Islands by macrocosm field observations on the biology, ecology, life cycle and abundance of Philaenus spumarius and other potential vectors in the Balearic Islands agroecosystems.

Task 2. Data collection in the Balearic Islands by microcosm observations on the biology, ecology, life cycle and abundance of Philaenus spumarius and other potential vectors in the Balearic Islands.

Task 3. Proposal on sampling protocols to be applied in field studies, including its fitness to Balearic Islands agroecosystems and its level of alignment/harmonisation with the examples provided in Appendix B of this Call.

Task 4. Identification of the major vectors of X. fastidiosa in the Balearic Islands by field studies and transmission assays under controlled condition.

2. Data and Methodologies

2.0. Selection of sampling sites and set up of sampling methods, geolocation and GIS database (Task 1.1).

The Balearic Islands archipelago is located in the Western Mediterranean (South-Eastern Spain) and includes four inhabited islands: Majorca, Minorca, Ibiza and Formentera and the National Park of Cabrera which is uninhabited. Majorca is the largest one (3640 Km²) followed by Minorca (695 Km²), Ibiza (571 Km²) and Formentera (83 Km²) (IBESTAT 2021). The Mediterranean climate of the archipelago is characterized by dry and hot summers and wet winters. In the Balearic Islands, the annual mean temperature is 21.8 °C and the annual mean precipitation is 456 mm (AEMET 2018). The vegetation landscape is mainly composed by pinewood, oaks and garrigue with mastic and wild olive, being 132,298 ha, the total land used for agriculture.

The agrosystems in where systematic sampling of vectors were conducted included: olive (Olea europaea L.), almond (Prunus dulcis Mill.), and vineyard (Vitis vinifera L.) orchards of at least 1 ha.

Additional host (border vegetation) included were: wild olive orchards (O. europaea var. silvestris), any species of coniferous plant, Quercus spp., Pistacia lentiscus, Cistus albidus, Cistus monspeliensis and Ceratonia siliqua. Citrus crops were agreed to be excluded from the study since no citrus plant have showed to be positive to X. fastidiosa in the Balearic Islands.

All sites for sampling were geolocated and included in a GIS database that is available at the GIS Service of UIB. Location and aerial pictures

of 2019

of the plots can be found in Annex A. For each of the plots, a buffer with a radius of 500 m from the centroid has been generated in order to study surrounding land cover type. The landcover was extracted from the SIOSE (http://www.siose.es) of 2014 from the Instituto Geográfico Nacional de España.

Climatic conditions in the selected orchards were recorded from the nearest weather station of the national network Agencia Estatal de Metereología (AEMET) (Annex B).

Long-term sampling (whole year) was carried only in Majorca. The islands of Minorca, Ibiza and Formentera were visited for two days twice a year (spring and autumn) in order to survey potential vector species and test the presence of X. fastidiosa.

(11)

2.0.0. Majorca

A total of nine organic farms were selected in Majorca (Table 1) in order to conduct a surveillance of the vector population (Fig. 2 and 3). We selected three olive farms, three vineyards and three almond ones located in the municipalities of Manacor, Felanitx, Algaida and Inca (see Annex A). Sampling in Majorca started the 20^th February 2018 and lasted until 31^st December 2020. Both, nymphs and adults were sampled with a biweekly frequency during all years of the grant. Criteria for selecting farms were easiness to access the plots and farmers cooperation, since at the time of starting the project, X.

fastidiosa outbreaks were a sensitive topic in the Balearics. In addition, all selected plots were under organic farming production, therefore, no intense application of synthetic pesticides was in place.

Table 1: Municipality and selected surface for sampling of the orchards of almond, olive and vineyard crops in Majorca selected for vector sampling.

Orchard Crop Municipality Surface of the farm (ha)

Selected surface for sampling (ha)

1 Olive Inca 2.3 2.1

2 Almond Inca 2.8 1.8

3 Almond Inca 73.4 2.7

4 Olive Inca 7.8 1.0

5 Vineyard Manacor 1.6 1.2

6 Olive Manacor 6.6 0.9

7 Almond Manacor 2.1 1.9

8 Vineyard Felanitx 6.5 0.6

9 Vineyard Algaida 1.8 1.1

(12)

Figure 2: Location of the selected plots for the monitoring of the X. fastidiosa vectors in Majorca. © SIG-UIB.

(13)

Figure 3: Plots sampled in Majorca. In brackets it is indicated municipality and date when picture was taken. A: Almond plot 1 (Manacor, 18/09/2019); B: Olive plot 1 (Manacor, 5/11/2019);

C: Olive plot 2 (Inca, 17/09/2019); D: Almond plot 2 (Inca, 17/09/2019); E: Olive plot 3 (Inca, 17/09/2019); F: Almond plot 3 (Inca, 17/09/2019); G: Vineyard plot 1 (Algaida, 18/09/2019); H: Vineyard plot 2 (Felanitx, 18/09/2019); I: Vineyard plot 3 (Manacor, 5/11/2019). Due to confidentiality, specific names of the different plots are not given. Exact location of plots and aerial pictures can be found in Annex A. © J. López-Mercadal.

2.0.1. Ibiza and Formentera

In November 2017, two days of sampling were conducted in Ibiza to confirm the presence of potential vectors on the island and collect them for the diagnosis of X. fastidiosa by qPCR. The sampling was carried out in the municipalities of Sant Carles, Santa Eulària and Sant Vicent (Fig. 4 and 5) prior to the start of the grant.

(14)

conditions. As in the first sampling in 2017, crops in Ibiza are highly mixed and we considered the most abundant crop to characterize the plots. We also conducted sampling in the border vegetation of the selected plots such as Pistacia lentiscus, Pinus spp., Ceratonia siliqua, Phillyrea spp.or Cistus spp. and areas of mixed natural vegetation (i.e. pine and prickly juniper).

The island of Formentera was sampled (Fig. 4 and 6) in June and November 2019 and 2020, to confirm the presence of potential vectors and to know its distribution since X. fastidiosa has not been detected in the island. We conducted the sampling in the main crops (only olive and vineyard since almond crops are not present in the island) (Table 3), the cover vegetation if present and in bordering shrubs.

Table 2: Selected orchards of almond, olive and vineyard crops in Ibiza for vector sampling.

Orchard Crop Municipality

1 Almond Santa Eulalia del Rio

2 Almond Santa Eulalia del Rio

3 Almond San Juan Bautista

4 Vineyard Santa Eulalia del Rio

7 Olive Santa Eulalia del Rio

8 Olive San Juan Bautista

9 Olive San Antonio Abad

Table 3: Selected orchards of olive and vineyard crops in Formentera for vector sampling.

10 Vineyard San Francisco Javier

11 Olive Es Pujols

12 Vineyard Son Ferran

13 Vineyard Pilar de la Mola

14 Olive Es Caló

(15)

Figure 4: Location of the selected plots for the monitoring of the X. fastidiosa vectors in Ibiza and Formentera islands. © SIG-UIB.

(16)

Figure 6: Plots sampled in Formentera. In brackets it is indicated the municipality. A: Vineyard plot 1 (Pilar de la Mola); B: Olive plot 1 (Es Caló); C: Olive plot 2 (Es Pujols); D: Vineyard plot 2 (Son Ferran); E: Vineyard plot 3 (San Francisco Javier). All pictures taken in 15/11/2019.

2.0.2. Minorca

In Minorca (Fig. 7 and 8), two days sampling were conducted in July 2018, June 2019 and 2020, November 2018 and 2019 and October 2020 in the selected plots (Table 4). Samplings were conducted in the main crops (olive and vineyard, almond), the cover vegetation if present and in bordering shrubs.

Table 4: Selected orchards of olive, vineyard and almond crops in Minorca for vector sampling.

1 Olive Ferreries

2 Olive Alaior

3 Olive Ciutadella

4 Vineyard Maó

5 Vineyard Alaior

6 Olive Alaior

7 Olive Alaior

8 Almond Alaior

9 Olive Maó

10 Olive Ciutadella

11 Vineyard Ciutadella

(17)

12 Vineyard Es Mercadal

13 Olive Maó

14* Vineyard Alaior

15* Vineyard Alaior

(*) Plots 14 and 15 are vineyards situated in the same plot as 2 and 7, respectively.

Figure 7: Location of the selected plots for the monitoring of the X. fastidiosa vectors in Minorca Island. © SIG-UIB.

(18)

Figure 8: Plots sampled in Minorca. In brackets it is indicated the municipality. A and B: Olive and Vineyard plots 1 (Alaior); C: Vineyard plot 2 (Ciutadella); D: Olive plot 2 (Ciutadella); E: Olive plot 3 (Ciutadella); F: Vineyard plot 3 (Ferreries); G: Vineyard plot 4 (Es Mercadal); H: Olive plot 4 (Alaior); I: Almond plot 5 (Alaior); J: Olive plot 5 (Alaior); K: Vineyard plot 5 (Alaior);

L: Vineyard plot 6 (Maó); M: Olive plot 6 (Maó); N: Vineyard plot 7 (Sant Lluís); O: Olive plot 7 (Sant Climent). All pictures taken in 8-9/11/2019. © J. López-Mercadal.

(19)

2.1. Methodologies

2.1.0. Data collection in the Balearic Islands by macrocosm field observations on the biology, ecology, life cycle and

abundance of Philaenus spumarius and other potential vectors in the Balearic Islands agroecosystems (Task 1)

2.1.0.1. Sampling of nymphs and adults (Task 1.1)

The following methodology for sampling vectors of X. fastidiosa in the Balearic Islands was adapted from a previous EFSA procurement (DiSerio et al. 2019).

Sampling units:

In all cases, the primary sampling unit (PSU) is represented by the sampled orchard/agroecosystem.

The secondary sampling unit (SSU) includes the area of herbaceous vegetation for the sampling of nymphs (SSUp); the area of herbaceous vegetation for the sampling of adults (SSUa); the tree habitat for the sampling of adults (SSUt) and the shrub habitat for the sampling of adults (SSUs).

Sampling variables:

Stages of the life cycle: adults (males and females) and nymphs were sampled. Eggs batches were not sampled.

Nymphs were categorized according to the stage of development (instar) as: N1- N2 (first and second nymphs’ instar); N3 (third instar inside the spittle); N4-N5 (fourth and fifth instar nymphs, inside the spittle and characterized by the presence of wing pads). When possible, N4 and N5 were identified separately.

For adults, males and females were identified, and when possible, at the level of polymorphism.

Sampling methods for nymphs:

Nymphs were sampled in the herbaceous vegetation from January until May-June by direct observation of spits produced by the nymphs. The sampling in January and February was aimed to determine the moment of zero nymphs and therefore the early detection in the following month.

A transect of 100 m was carried out in each orchard. A total of 30 samples were taken randomly for each transect, consisting of the counting of spits on plants per SSUp in a surface of 0.25 m² delimited by a wooden frame (Fig. 9).

All nymphs per plant were counted and the position in the plant (bottom third, medium third and upper third) was determined. Also, the number of nymphs included in each spit was estimated and categorized

(20)

The herbaceous plant coverage and dominant herbaceous species in the sample site was also identified.

If needed, specimens and pictures were taken for confirmation of the plant species.

Sampling methods for adults:

Sampling of adults was conducted by using a triangle shaped sweep net (Fig. 10). Each side of the triangle was 38 cm and the handle was telescopic from 45 cm to 75 cm long. The front part of the sweep net was flexible, and the other sides were made with metal. The fabric was white and made of polyester fibers.

For the adult samplings in Ibiza in November 2017 (prior to the approval of the grant), we performed transects of 100 sweeps on the predominant cover vegetation of the different mixed crops (e.g., olive and carob trees).

For the sampling in Majorca, Minorca, Ibiza and Formentera carried out from 2018 to 2020, adults were collected by using a sweep net in all SSU: trees (SSUt), cover (SSUa) and bordering vegetation (SSUs)

Herbaceous vegetation: Adults were sampled from herbaceous vegetation by the counting of adults per SSUa. Collected adults were counted, sexed and identified. Ten sweeps were conducted on five sites of 2 m² randomly selected from each plot. Adults were collected for X. fastidiosa detection, molecular taxonomy of the vectors and for voucher specimens, as well as to conduct the microcosm trials and for the acquisition- transmission experiments.

Sampling on olive trees: A total of six trees per site were sampled by using the sweep net (≈20 sweeps) around all the canopy of the tree, between 1 m and 1.5 m up and down. The counting of adults per SSUt on an individual tree allows estimating the number of adults per tree. Data in this report is expressed as number of adults per unit of sampling effort (adults/sweep). The first tree was selected randomly and thereafter, one in three following the crop row were sampled. A total of five replicates per site were conducted. Phenology of olive trees was determined according to the BBCH standards (Sanz-Cortés et al, 2002).

Sampling on almond trees: Sampling was similar to the one performed for olive trees. A total of six trees per site were sampled by using the sweep net (≈20 sweeps) around all the canopy of the tree. The counting of adults per SSUt on an individual tree allowed to estimate the number of adults per tree. Data in this report is expressed as number of adults per unit of sampling effort (adults/sweep).

The first tree was selected randomly and thereafter, one in three following the crop row were sampled.

A total of five replicates per site was conducted. Phenology of almond trees was determined according to the BBCH standards (Thomas, 2018).

Sampling on vineyard trellises: Since individual vineyard plants are difficult to sample separately, around 2 m² of vineyard plants were sampled down to up along the vineyard trellises by using a sweep net. A total of six samples per trellises were collected and five replicates were conducted.

Data in this report is expressed as number of adults per unit of sampling effort (adults/sweep).

Phenology of vineyard was determined according to the BBCH standards (Lorenz et al. 1995).

Sampling on alternative hosts: Sweep net was also used on alternative hosts, particularly on shrubs (i.e., Pistacia lentiscus). When possible and depending on the size of the plant, no less than

(21)

30 sweeps were conducted in the selected hosts. Data in this report is expressed as number of adults per unit of sampling effort (adults/sweep).

Figure 9: Wood frame 0.25 m² surface used for nymph sampling. © J. López-Mercadal.

Figure 10: Example of sweep net for Aphrophoridae adult sampling in an olive orchard. © J. López-Mercadal.

2.1.0.2. Evaluation of chromotropic traps (Task 1.2)

(22)

Figure 11: Example of a chromotropic trap set up in SSUt in an almond plot. © J. López- Mercadal.

The trial was carried out from 11^th June to 16^th December 2020 in three of the plots selected for Task 1.1, in particular an olive plot (plot 5), a vineyard (plot 9) and an almond plot (plot 3). Traps were placed in the SSUa, SSUt and SSUs of each plot. Traps were checked, replaced and rotated weekly according to a Latin Square design (Fig. 12).

Figure 12: Model of the Latin Square used for coloured sticky trap comparison. B=blue, W=white, R=red, Y=Yellow.

Comparison of captures in the different traps was conducted by using a Wilcoxon Mann Whitney test with Bonferroni Post Hoc correction.

2.1.0.3. Molecular taxonomy of potential vector species (Task 1.3)

The objective was to characterize the vectors of X. fastidiosa in the Balearic Islands. With this purpose, we used the Folmer fragment from the Cytochrome Oxidase I gene region from the mitochondrial genome. This fragment has been extensively used to identify insect species as it shows a high

X. fastidiosa

(23)

been extensively explored. Our objective was also to relate morphotypes and infection rates with haplotype diversity. For comparative purposes, we also amplified the Cytochrome b (cytB) fragment.

Individuals of P. spumarius and N. campestris were collected in the field by using a sweep net. Once in the lab, they were identified morphologically, photographed and dissected in order to: i) send the head to the Microbiology lab at UIB for X. fastidiosa detection; ii) preserve in alcohol 96º and –20 ºC the abdomen, posterior legs and wings for voucher and iii) use the thorax for DNA extraction.

DNA extraction

DNA extraction was conducted according to the manufacturer’s protocol (Qiagen DNA DNeasy Blood &

Tissue Kit). A single variation was included: instead of eluting the DNA adding 200 μl buffer AE, 100 μl was used.

PCR primers and conditions - In the case of COI:

- LCO1490 (Forward) 5’-GGTCAACAAATCATAAAGATATTGG-3’

- HCO2198 (Reverse) 5’-TAAACTTCAGGGTGACCAAAAAATCA-3’ Folmer primers - For the amplification of the cytB gene region

-

CB-N3665 (Forward) GTCCTACCATGAGGTCAAATATC

-

CB-N11526 (Reverse) TTCAACTGGTCGTGCTCC

- TaqPolimerase: Supreme NZYTaq II 2x Green Master Mix - PCR reaction volume: 50 μl

- PCR conditions: 95 ºC x 3’ + (35 x [ 95 ºC x 30’’ + 50 ºC x 30’’ + 72ºC x 1’]) +72 ºC x 10’

DNA purification: according to the manufacturer’s protocol (Qiagen QIAquick PCR Purification Kit). We only have changed the last step: instead of eluting the DNA adding 50 μl buffer EB or water, we used 30 μl Milli-Q water.

The purification product was sent for sequencing at the Science and Advice for Scottish Agriculture (SASA- Scotland). DNA was sequenced in both forward and reverse strand directions.

Sequences were analyzed and aligned with the CodonCode software and phylogenetic reconstruction was conducted with softwares Mr.Bayes and Mega. A haplotype network analysis was also carried out to establish mutational steps and dominant haplotypes in the Balearics. In this case, we used the PopArt software.

2.1.1. Data collection in the Balearic Islands by microcosm

observations on biology, ecology, life cycle and abundance of Philaenus spumarius and other potential vectors in the Balearic Islands (Task 2)

In order to study the biological cycle in microcosm conditions of the potential vectors, a total of 50

(24)

Figure 13: Microcosm placement in Ca’s Valencià located at the University of the Balearic Islands. © J. López- Mercadal.

In the trial conducted between 2018 and 2019, we set up 10 cages for each of the following plants species placed in plastic pots (20 cm x 35 cm): Rosmarinus officinalis, Mentha sativa, Ocimum basilicum, Pistacia lentiscus and Lavandula officinalis. Then a mix of grass seeds were planted in the same soil (Fig. 14). Furthermore, we added straw for the egg laying of Aphrophoridae adults. In subsequent years (2019 to 2021), we replaced the plastic pots by fibre bags in order to facilitate movement of the insects in the cage. Also, we replaced Mentha sativa by Mentha x piperita and Lavandula officinalis by Lavandula dentata due to the supplier availability.

Figure 14: Example of a microcosm cage including Rosmarinus officinalis, 2018 to 2019 (A) and 2019 to 2021 (B) systems. © S. Delgado and J. López-Mercadal.

(25)

In 2018, one male and one female of Aphrophoridae were placed in each cage between 19/09/2018 and 24/10/2018. All of them were P. spumarius, except one cage of L. officinalis where a couple (male and female) of N. campestris was introduced. The insects were not removed from the cages and observation about oviposition in the straw pieces was carried out between 11/02/2019 and 26/02/2019.

In 2019, only P. spumarius adults were used. The couples were added between 25/09/2019 and 17/10/2019. The insects were inspected every two or three weeks. Then males and/or females were added in the cages if dead of initial adults was confirmed. The insects were not removed from the cages and observation about oviposition in the straw pieces was carried out between 31/01/2020 and 04/02/2020. At this time, first nymphs were detected and bionomics were checked every two days.

In 2020, both P. spumarius and N. campestris species were used for the microcosm trials (Fig. 15).

Eight plants of each plant species contained P. spumarius and two plants N. campestris. Then, the procedure was the same as in 2019 trials. Observation about oviposition in the straw pieces was carried out the 21/12/2020.

Figure 15: Example of a microcosm cage with Rosmarinus officinalis plant and an adult of P. spumarius morphotype marginella. © J. López-Mercadal.

2.1.2. Proposal on sampling protocols to be applied in field studies,

including its fitness to Balearic Islands agroecosystems and

its level of alignment/harmonisation with the examples

(26)

The literature search included the following strings: “vector” and “Xylella” and “Cicadomorpha” and

“Cicadellinae” and “Aphrophoridae” and “sharpshooter” and “spittlebug” or “Philaenus” or

“Neophilaenus” and “sampling”; species names of vectors from other regions (e.g. America) were not included since it was considered that subfamily and family levels were enough for retrieving representative information about sampling methods. Philaenus and Neophilaenus genera were included as they are considered the major vectors in Europe and therefore, the main target for the review and the sampling guidelines produced here.

Search was restricted to indexed publications available since year 2000 up to June 2020. A second search was conducted for publications included in the database from July 2020 to May 2021. The bibliographic database used was Web of Science (Clarivate Analytics) (includes: WOS, CCC, DIIDW, KJD, MEDLINE, SCI-EXPANDED, SCieLO). No language restriction was included in the search.

In addition, several non‐peer reviewed publications and communication to congresses (i.e., EFSA International Xylella Conferences) were included when content was considered relevant for the review and the guidelines.

Publications were selected after screening of title and abstracts by at least two reviewers and duplicates were removed. Publications were included in the literature review when information about the sampling method of the specimens of Cicadomorpha was provided in the Material and Methods section, even if the aim of the study was not directly related to X. fastidiosa (i.e., genetic studies of insects). When available, information about sampling methods was extracted and categorised according to the following categories of sampling methods in an Excel sheet: quadrant method; sweeping net; sticky traps;

aspirator; beating tray; other methods (e.g.: direct observation).

Therefore, information was retrieved about the most frequent methods used to sample different Cicadomorpha families, including those that are transmitters of X. fastidiosa. Special emphasis was given to those species of Aphrophoridae that are considered major vectors of X. fastidiosa in Europe: P.

spumarius, P. italosignus and N. campestris.

All taxonomic information about Cicadomorpha was retrieved from https://www.gbif.org/ that compiles different Taxon Identifiers such as ITIS, Fauna Europaea, Encyclopaedia of Life, EPPO… among others.

As an example, in the case of Philaenus spumarius, the Taxon Identifiers are the following: NCBI taxonomy ID : 36667 ITIS TSN : 200139 Freebase ID : /m/0gmg831 Encyclopaedia of Life ID : 1691692 GBIF taxon ID : 2016038 Fauna Europaea ID : 239414 Dyntaxa ID : 234561 New Zealand Organisms Register ID : 0e4e7f83-6d93-485c-bdc4-8af4b89c33c9 ARKive ID : Philaenus-spumarius EPPO Code : PHILSU iNaturalist taxon ID : 56189 TAXREF ID : 241085 NBN System Key : NHMSYS0020705811 Nederlands Soortenregister ID : 159409 BugGuide ID : 7452 ADW taxon ID : Philaenus_spumarius Fauna Europaea New ID : 6574dd0c-f2a9-4c76-a0eb-0dff1cdc5015 IRMNG ID : 10719259 Czech NDOP taxon ID : 54137 BioLib taxon ID : 94952 Encyclopædia Britannica Online ID : animal/meadow- spittlebug COOL species ID : 2524 eBiodiversity ID : 88145 Belgian Species List ID : 6980 Finnish Biodiversity Information Facility's Species List ID : MX.229021 Microsoft Academic ID : 2775927324 Observation.org ID : 158519 BOLD Systems taxon ID : 25797 NBIC taxon ID : 110898 EUNIS ID for species : 259789. In this report, scientific names of Cicadomorpha species have been updated from some outdated publications accordingly to the last accepted taxonomy, and when synonyms were detected, it is indicated the actual accepted name and the synonym name.

(27)

Based on the protocol provided by EFSA for the call of this grant (DiSerio et al. 2019), the experience gained by the authors conducting the grant and the information collected from the literature search, a guideline for sampling methods of Aphrophoridae including major agroecosystems present in the Balearic Islands was developed. The methods were described and pros and cons were specified. The guideline was circulated among two European experts and EFSA officers that provided inputs.

2.1.3. Identification of the major vectors of Xylella fastidiosa in the Balearic Islands by field studies and transmission assays under controlled condition (Task 4)

In order to assess the vector role of the different Aphrophoridae species found in the Balearic Islands, vector competence test under controlled conditions were performed. All vector competence test were conducted in insect-proof cages placed at the biosecurity greenhouse (Fig. 16) in the experimental plot of Ca’s Valencià at the Campus of UIB, as well as in the biosecurity (BSL2) insectary at UIB.

Figure 16: Biosecurity greenhouse in the experimental plot Ca’s Valencià (Campus UIB).

Insects:

Adults of potential vectors species were collected from areas of Majorca where plants were confirmed to be positive to X. fastidiosa. Insects were collected following the methods described in 2.2.1.

(28)

Plants used for the transmission experiments were X. fastidiosa free Medicago sativa plants. All plants (25) were grown in confinement conditions (insectary at UIB) to avoid any contact with field vectors and then 20 plants were moved outside in insect- proof cages, while five plants remained at the insectary. Alfalfa was selected because according to literature is susceptible to the infection of several subspecies of X. fastidiosa, such as fastidiosa and multiplex that are present in Majorca (EFSA 2020).

In addition, initial attempts of using periwinkle (Catharanthus roseus) from seeds provided by Dr. D.

Bosco, failed due to unexpected low growing of plants both in the insectary and in insect-proof cages placed in the experimental plot at the campus of UIB.

Method for transmission:

The insects collected in the field were caged in groups of three to five individuals with M. sativa X.

fastidiosa free plants for 96 hours for the inoculation access period (IAP) (Fig. 17), depending on the field availability. In 2018, 5 cages (Polypropylene, 30x30x30 cm) with M. sativa plants were placed into the insectary (25 °C / 70-80 % HR) with P. spumarius and N. campestris insects and 20 in the experimental plot. The transmission tests conducted in 2018 were set up from 27/10/2018 until 05/02/2019. We tested the inoculation with 110 P. spumarius and 15 N. campestris (see Annex C).

After the IAP period, heads of insects were dissected and eyes removed to determine X. fastidiosa presence in the vector by qPCR (EPPO, 2016). Plant samples were analysed to confirm the bacterium transmission by vectors 15, 30, 45 and 60 days after the inoculation period.

Figure 17: Inoculation cages used to maintain the vectors in contact with the plants in the insectary (A) and in the experimentation plot (B). © M.A. Tugores and J. López-Mercadal.

The transmission tests carried out in 2019 were set up from 24/09/2019 until 20/11/2019 (see Annex C). A total of 27 M. sativa plants were set at the insectary for the tests. We tested the inoculation with 75 P. spumarius and 39 N. campestris. The methodology was the same carried out in 2018 trials.

Finally, the transmission tests were repeated in 2020, conducted from 15/09/2020 until 27/12/2020 (see Annex C). A total of 30 M. sativa plants were set at the insectary for the tests. We tested the inoculation with 116 P. spumarius and 34 N. campestris. The methodology was the same carried out in 2018 and 2019 trials.

2.1.3.1. Xylella fastidiosa detection in vectors and plants

Molecular analysis for the diagnosis of X. fastidiosa was performed from the heads of the vectors with eyes previously removed. DNA was extracted using the standard procedure based on CTAB DNA extraction by PCR to assess infection prevalence (EPPO 2016), using glass beads (710-1,180mm) instead of tungsten beads for the disruption of the head. DNA obtained for each vector was resuspended in 30 µl of water milliQ. The presence of X. fastidiosa was assessed by real time PCR following the EPPO procedures (EPPO 2019). A gene coding for the 16S rRNA processing RimM protein was amplified in triplicate by real-time PCR, following the Harper et al. 2010, erratum 2013, test. Controls were included

A B

(29)

acid. Controls included were the negative isolation control (NIC) to monitor contamination during nucleic acid extraction, the negative amplification control (NAC) to rule out false positives due to contamination during the preparation of the reaction mix and positive amplification control (PAC) to monitor the efficiency of the amplification.

Samples with the three triplicates with a Ct value lower than 35 were considered positive. Ct values higher than 35 or without the three triplicates positives were considered unclear results, and the analysis was repeated to confirm the result.

rpoD gene by conventional PCR (Minsavage et al. 1994) was amplified from the positive X. fastidiosa samples and amplicons obtained were sequenced to determine the subspecies of X. fastidiosa. In order to determine the sequence type a nested MLST PCR based was used (Cesbron et al. 2020) increasing sensitivity and/or specificity of Yuan’s PCR (Yuan et al. 2010). Anyhow, only two housekeeping genes are required for an assignment of X. fastidiosa subspecies, and only full MLST is compulsory if it is a new outbreak or new hosts (EPPO 2019). Therefore, due to the small amount of DNA obtained from positive samples, we amplified by nested PCR the cysG gen (sirohaem synthase), leuA gen (2- isopropylmalate synthase) and malF gen (ABC transporter sugar permease), these genes will help to differentiate between the sequence types recently described in Balearic Islands (ST1, ST80 and ST81).

PCR conditions were defined in the EPPO procedure (EPPO 2016). Furthermore, a nested PCR protocol for the rpoD gene (unpublished paper) was developed in the laboratory in order to increase the pitfall that suppose the lower concentration of bacteria in some samples (samples with Ct values >32), following the same criteria as nested MLST-PCR.

All the amplified samples were checked by 1.5 % (p/v) agarose gel, purified by Multiscreen filter plates PCR (MSNU03010 Merck Millipore) and sequenced using the Sequencer 3130 of Applied Biosystems.

It is worth to mention that the positive amplification from the rpoD gene or the MSLT genes failed on some occasions, either by using the conventional PCR or the nested-PCR, although the samples were clearly positive to X. fastidiosa, probably due to the presence of inhibitors or the low pathogen-DNA concentration.

3. Assessment/Results

3.0. Geolocation, meteorological data and GIS database

Data about the geolocalization of the selected plots can be found in Annex A. Analysis of landcover in a buffer area of 500 m radius surrounded each of the plots indicated that the plots and surroundings were adequate for the development of the vectors of X. fastidiosa. In general, the most frequent category of soil occupancy was “Herbaceous crops”, followed by “Mixed crops with vegetations”, “Fruit trees (non citrus)” and “Mixed forest”. Results on the meteorological parameters (Temperature and Precipitation) in the municipalities of Majorca where the sampling was conducted were nearly the same. In the Annex B we represent the median temperature (ºC) and the precipitation (mm) for 2018 to 2020. Among those years the mean temperature was 17 ºC and the precipitation had a mean value of 40.1 mm, reaching the maximum in 2018 with 47 mm. In the municipality of Inca the mean temperature among the years was about 17.1 ºC with a precipitation of 41.4 mm. In Manacor, the mean value of temperature was

(30)

3.1. Analysis of plant phenology

The description of the phenology of olive and almond crops was conducted during 2020 according to BBCH standards about growth stages (GS). In the case of olives, during January until 19^th of February trees showed the buds in development (01-03-07-09 GSs) and apical leaves starting its development (11 GS). The 19^th of February started inflorescence development (53 GS) and flowering (60-65 GS) until early May, when 12^th of May fruit development (71 GS) was detected. Fruit ripening (81-89 GS) lasted until October when olives were collected.

In the case of almond trees, in January bud (00-01 GS) and leaf development (11-19 GS) were observed in the field until 5^th of February when the inflorescence appeared (51-53 GS). Fully flowering (60-61- 65-67 GS) and leaf development were observed until mid-March as the 19^th we detected the fruit development (72 GS). Fruit ripening (81 GS) occurred from May until the 9^th of July when the separation of the fruit exocarp started (87 GS), being completely matured (90 GS) by the end of the month until October. Then, trees lost leaves and the rest of exocarps.

For vineyard, in January 2020 we observed different GGs from dormant bud (00 GS), bud sweeling (01 GS), bud opening (09 GS) and first leave opening (11 GS). Then, the 5^th of February vine plants were pruned and the 20^th of March leaves started to open (13 GS). The 15^th of April leaves were entirely open (19 GS) and inflorescence were clearly visible (53 GS). The 29^thof April, flowers were closely pressed together (55 GS). The 13^th May flowers started separating (61-68 GS) and the 27^th development of fruit started (71 GS). Then, fruit started ripening (81) until grape collection in August-September and leave decolouration and falling started (91-95) until the end of the year. Total leave falling (97 GS) was observed by 26^th December.

3.2. Data collection in the Balearic Islands by macrocosm field

observations on the biology, ecology, life cycle and abundance of Philaenus spumarius and other potential vectors in the Balearic Islands agroecosystems (Task 1)

3.2.0. Population dynamics and phenology

3.2.0.1. Pre-imago phenology of the potential vectors in Majorca

In general, considering all data collection from 2018 to 2020, nymphs of the vector species of X.

fastidiosa, P. spumarius and N. campestris, were observed in field conditions (macrocosm) in Majorca from March to early June (Fig. 18). The nymphs of P. spumarius were more abundant (0.03 nymphs/m²), while the density of nymphs of N. campestris (0.005 nymphs/m²) was twelve times lower than P.

spumarius. The peak of nymph abundance was between end-March and early-April (Fig. 18).

(31)

Figure 18: Seasonal pattern and abundance of P. spumarius and N. campestris nymphs in Majorca from 2018 to 2020.

In regard to the density of nymphs per crop (almond, olive and vineyard), for P. spumarius, the highest density (nymph/m²) of nymphs was detected in the olive plots (0.08-5.55 nymph/m²) followed by vineyard and almond crops (Fig. 19a and 19b) both in 2018 and 2019. Contrary, in 2020 highest nymph density was detected in vineyard plots (0.05-0.45 nymph/m²), followed by olive and almond plots (Fig.

19c). In general, all crops showed the highest density of nymphs between the 3^rd week of March and the 1^st of April. In 2018 no nymphs were detected during the 1^st week of March, but they were detected in all crops during the 3^rd week of March. In 2019 the sampling started in February and the first nymphs were detected during the 1^st week of March. In 2020 the sampling started in January and first nymphs were detected the first week of March in vineyard and olive crops and the third week of March in olive crop. In our area, the first populations of nymphs were detected between the 4^th week of February and the 1^st-2^nd week of March, depending on the climatic conditions of the year that may drive nymphal survival. In 2018 and 2020 nymphs were detected in all crops until the 1^st week of May, while in 2019 nymph detection was extended until the 1^st week of June. From the obtained results, nymphs of P.

spumarius are detected in the cover vegetation of the different crops (olive, vineyard and almond) from early March to the end of May, depending on the climatic conditions of the year.

(32)

Figure 19: Seasonality of P. spumarius nymphs in 2018 (a), 2019 (b) and 2020 (c) in Majorca per crop.

Regarding the instar distribution of nymphs (Fig. 20), instars of nymphs from N1 to N5 increased over time either for 2018, 2019 and 2020. N2 and N3 were more frequent in March and early April, while N4 and N5 were more frequent in late April-May. We detected nymphs (low population) in early June 2019.

Nymphs N1 were not detected in 2018 and only low population during the 1^st week of March 2019 and 2020. N1 nymphs are difficult to identify in the field due to its little size, their position at the bottom of the plants and the difficulty to identify differently from N2. In general, nymphs of P. spumarius were detected in the field from March to May.

(33)

Figure 20: P. spumarius nymph instars distribution in 2018 (a), 2019 (b) and 2020 in Majorca.

The highest density of nymphs of N. campestris was detected in olive and almond crops during the 3^rd week of March in 2018, the 1^st week of March in 2019 and the 1^st week of April in 2020 (Fig. 21). Density of nymphs decreased substantially from the first week of April being similar in all crops (0.2-0.7 nymphs /m²) except in 2020. Nymphs were absent in the almond crop during the 3^rd week of April in 2018, during the 1^st and 3^rd weeks of May in 2019 and from the 3^rd week of April in 2020. Last detection of nymphs was in vineyard and olive crops during the 3^rd week of May in 2019. Considering the timeframe of sampling we applied (biweekly) and the results from three years, N. campestris nymphs were detected from the 1^st - 2^nd week of March to the 4^th week of April in vineyard and olive crops, while nymphs seemed to be absent earlier (3^rd week of April) in the almond crop. In 2020, N. campestris nymphs were difficult to detect, as few nymphs were observed from the 3^rd week of March until the 2^nd week of April. This differences among the years could be due to environmental conditions, mainly precipitation. Furthermore, N. campestris nymphs were much difficult to detect in the field in comparison to P. spumarius nymphs due to its life cycle linked with Poaceae plants and its location, usually at the bottom position of the plant.

(34)

Figure 21: Seasonality of N. campestris nymphs in 2018 (a), 2019 (b) and 2020 (c) in Majorca.

The seasonal distribution of nymph instars of N. campestris showed similar pattern as in the case of P.

spumarius. Youngest nymphs (N1-N2) were found from early March to early April, while N4 and N5 were found mainly in late April (Fig. 22).

(35)

Regarding the position in the plant (upper, medium, bottom), we observed a trend for the bottom position in N. campestris in all years of sampling (Fig. 23). For P. spumarius, in 2018 we did not observe any clear pattern of position, however in 2019 the highest number of nymphs was found in the middle part of the plant.

(36)

Figure 23: Position on the plant of the nymph instars in 2018 (a), 2019 (b) and 2020 (c) in Majorca.

Analyzing the position of the nymphs in the cover vegetation by crop, we observed that in 2019 and 2020 nymphs of P. spumarius were detected most frequently at the medium part of the plants for all the crops (Fig. 24). In 2018, P. spumarius nymphs were detected in all crops with no much differences in the position in the plant. In the case of N. campestris, in 2018 and 2019 nymphs were detected at the base of the plants for all crops, but in 2020 in olive some were detected at the upper position of plants and in vineyard at the medium position on plants (Fig. 24).

Collection of data and information in Balearic Islands on biology of vectors and potential vectors of Xylella fastidiosa (GP/EFSA/ALPHA/017/01)

EXTERNAL SCIENTIFIC REPORT