THE GUT MICROBIOTA CONTRIBUTES TO DISEASE IN A MOUSE MODEL WITH SPONTANEOUS BILE DUCT INFLAMMATION
Elisabeth Schrumpf1,2,3,*, Martin Kummen1,2,3,*, Laura Valestrand1,2,3,4, Thomas U. Greiner5, Kristian Holm1,2,3, Velmurugesan Arulampalam6, Henrik M.
Reims7, John Baines8,9, Fredrik Bäckhed5, Tom H. Karlsen1,2,3,4,Richard S.
Blumberg10, Johannes R. Hov1,2,3,4, Espen Melum1,2,3,4.
1Norwegian PSC Research Center, Division of Surgery, Inflammatory
Medicine and Transplantation, Oslo University Hospital, Rikshospitalet, Oslo, Norway. 2K.G. Jebsen Inflammation Research Centre and Institute of Clinical Medicine, University of Oslo, Oslo, Norway. 3Research Institute of Internal Medicine, Division of Surgery, Inflammatory Medicine and Transplantation, Oslo University Hospital, Rikshospitalet, Oslo, Norway. 4Section of
Gastroenterology, Division of Surgery, Inflammatory Medicine and Transplantation, Surgery, and Transplantation, Oslo University Hospital, Rikshospitalet, Oslo, Norway. 5The Wallenberg Laboratory and Sahlgrenska Center for Cardiovascular and Metabolic Research, Department of Molecular and Clinical Medicine, Institute of Medicine, University of Gothenburg,
Gothenburg, Sweden. 6Core Facility for Germfree Research (CFGR),
Department of Comparative Medicine and Department of Microbiology, Tumor and Cell Biology (MTC), Karolinska Institutet, Stockholm, Sweden.
7Department of Pathology, Oslo University Hospital, Rikshospitalet, Oslo, Norway. 8Max Planck Institute for Evolutionary Biology, Plön, Germany.
9Institute for Experimental Medicine, Christian-Albrechts-University of Kiel, Kiel, Germany. 10Division of Gastroenterology, Hepatology and Endoscopy, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA. *Shared first authorship.
Corresponding author:
Espen Melum, Norwegian PSC Research Center, Division of Surgery, Inflammatory Medicine and Transplantation, Oslo University Hospital, Rikshospitalet
Postboks 4950 Nydalen, 0424 Oslo, Norway.
E-mail: [email protected]
Telephone number: +47 91780732, Fax number: +47 23073928 Keywords: germ free; microbiota; NOD.c3c4; PBC; PSC
Abbreviations: PBC, primary biliary cirrhosis; PSC, primary sclerosing cholangitis; IBD, inflammatory bowel disease; GF, germ free; Mdr2-/-,
multidrug resistance knockout; CONV-R, conventionally raised; MDU, minimal disease unit; CBDD, common bile duct dilatation; H&E, hematoxylin and eosin; ALT, alanine transaminase; AST, aspartate transaminase; ALP, alkaline phosphatase; CCl4,carbon tetrachloride.
Electronic word count: 5608 Number of figures: 5
Number of tables: 1
Conflict of interest: All authors have completed the ICMJE uniform
disclosure form at www.icmje.org/coi_disclosure.pdf and declare: no support from any organisation for the submitted work; no financial relationships with any organisations that might have an interest in the submitted work in the previous three years; no other relationships or activities that could appear to have influenced the submitted work.
Financial support: The study was supported by the South Eastern Norway Regional Health Authority (project number 2012024), the Norwegian
Research Council (project number 240787/F20), US National Institutes of Health (DK44319 to R.S.B.), PSC Partners and the Norwegian PSC Research Center.
Author´s contributions: E.M., E.S. and M.K. designed the experiments.
E.S., L.V. and M.K. performed the experiments. E.S., M.K. and K.H.
performed data analysis. T.U.G. and F.B. provided control material. V.A.
administered the GF mouse colony. J.B. assisted with sequencing. H.M.R.
evaluated histological slides. E.M., J.H., T.H.K., F.B., J.B. and R.S.B.
supervised different experiments and contributed with new ideas throughout the project. E.S., M.K. and E.M. drafted the manuscript. All authors revised the manuscript and approved the final version.
ABSTRACT
Background & Aims: A strong association between human inflammatory biliary diseases and gut inflammation has led to the hypothesis that gut microbes and lymphocytes activated in the intestine play a role in biliary inflammation. The NOD.c3c4 mouse model develops spontaneous biliary inflammation in extra- and intra-hepatic bile ducts. We aimed to clarify the role of the gut microbiota in the biliary disease of NOD.c3c4 mice.
Methods: We sampled cecal content and mucosa from conventionally raised (CONV-R) NOD.c3c4 and NOD control mice, extracted DNA and performed 16S rRNA sequencing. NOD.c3c4 mice were rederived into a germ free (GF) facility and compared with CONV-R NOD.c3c4 mice. NOD.c3c4 mice were also co-housed with NOD mice and received antibiotics from weaning.
Results: The gut microbial profiles of mice with and without biliary disease were different both before and after rederivation (unweighted UniFrac- distance). GF NOD.c3c4 mice had less distended extra-hepatic bile ducts than CONV-R NOD.c3c4 mice, while antibiotic treated mice showed reduction of biliary infarcts. GF animals also showed a reduction in liver weight
compared with CONV-R NOD.c3c4 mice, and this was also observed in antibiotic treated NOD.c3c4 mice. Co-housing of NOD and NOD.c3c4 mice indicated that the biliary phenotype was neither transmissible nor treatable by co-housing with healthy mice.
Conclusions: NOD.c3c4 and NOD control mice show marked differences in the gut microbiota. Germ free NOD.c3c4 mice develop a milder biliary
affection compared with conventionally raised NOD.c3c4 mice. Our findings
suggest that the intestinal microbiota contributes to disease in this murine model of biliary inflammation.
Electronic word count, Abstract: 250
LAY SUMMARY
Mice with liver disease have a gut microflora (microbiota) that differs substantially from normal mice. When these mice, that under normal
circumstances spontaneously develops disease in their bile ducts, are raised in an environment devoid of bacteria, the disease in the bile ducts diminishes.
Overall this clearly indicates that the bacteria in the gut (the gut microbiota) influences the liver disease in these mice.
INTRODUCTION
NOD.c3c4 mice spontaneously develop biliary inflammation in intra-hepatic and extra-hepatic bile ducts [1]. The NOD.c3c4 model is developed on the NOD background [2], a genetic background with increased susceptibility to autoimmune phenotypes similar to what is seen in human biliary diseases [3], and the regular NOD mice develop diabetes [4]. In contrast, NOD.c3c4 mice do not develop diabetes [2]. The NOD.c3c4 mouse has been used as a model of the human biliary disease primary biliary cirrhosis (PBC) as it develops autoantibodies and lymphocytic infiltrates similar to PBC [2]. The
pathogenesis in NOD.c3c4 mice is not completely clarified, but the biliary disease is considered to be immune mediated [5]. The NOD.c3c4 mouse is the only known mouse model that spontaneously develops dilatation and inflammation of the common bile duct [6]. These features are hallmarks of the human biliary disease primary sclerosing cholangitis (PSC) and as such this mouse model can also be used to model aspects of PSC.
Inflammatory biliary diseases are strongly associated with gut diseases [7,8].
This clinical association has led to the hypothesis that gut microbes and lymphocytes activated in the intestine play a role in biliary inflammation [7].
That gut microbiota could play an important role in bile duct disease is experimentally supported by studies showing that small bowel bacterial overgrowth in rats leads to bile duct inflammation that can be treated with antibiotics [9,10]. From human cholangiopathies it has recently been
demonstrated in several independent studies that patients with PSC have a different gut microbiota compared to healthy individuals [11–14] and in line
has shown beneficial effects [15]. A recent study demonstrated that germ free (GF) multidrug resistance knock out (Mdr2-/-) mice developed more severe liver disease compared with conventionally raised (CONV-R) Mdr2-/- mice [16]. The Mdr2-/- mouse is a common mouse model of PSC [6], as it develops periductal fibrosis due to regurgitation of bile into portal tracts [17]. The
NOD.c3c4 model contrasts the Mdr2-/- model as the biliary disease of the NOD.c3c4 model is largely immune driven, but with minimal fibrosis [1].
In the present study, we explored the role of the intestinal microbiota in the biliary inflammation observed in NOD.c3c4 mice. We found significant differences between the gut microbiota of NOD.c3c4 mice and NOD control mice. In experiments with rederivation into a GF environment we found that GF NOD.c3c4 mice were protected from biliary disease compared with CONV-R NOD.c3c4 mice. Also, when NOD.c3c4 mice were treated with antibiotics we saw a milder liver phenotype corroborating the GF results.
Collectively, the present results suggest that intestinal bacteria contribute to disease in this murine model of biliary inflammation.
MATERIALS AND METHODS Mice
NOD.c3c4 and NOD mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). All CONV-R mice were housed in a Minimal Disease Unit (MDU) at the animal facility at Oslo University Hospital Rikshospitalet, Oslo, Norway.
NOD.c3c4 and NOD mice housed in the MDU facility, were harvested at 10 weeks of age and cecal content and mucosa was sampled. NOD.c3c4 and NOD strains were then rederived into a new MDU facility by caesarean sections, and after three generations sampling of cecal content and mucosa was repeated. These rederived NOD.c3c4 mice were then rederived as axenic mice at the Core Facility for Germfree Research at Karolinska Institutet, Stockholm, Sweden by caesarean sections, housed in a GF environment and regularly monitored to ensure their GF status. GF and CONV-R NOD.c3c4 mice were sampled at 9 weeks and 18 weeks of age. GF NOD mice were housed at a GF facility at the University of Gothenburg, Sweden. In co-housing experiments age- and gender- matched CONV-R NOD.c3c4 mice and NOD mice were co-housed in a MDU facility from the age of 4 weeks (after weaning) for 4 weeks. CONV-R NOD.c3c4 mice were treated with non-absorbable antibiotics; Ampicillin 1.0 g/l (Bristol-Myers Squibb, Solna, Sweden) and Neomycin 0,5 g/l (Fisher Scientific, Geel
Belgium) in drinking water from weaning for 4 weeks. The number of animals in each experiment was determined by power calculations and experience from similar experiments.
All animal experiments were approved by the Norwegian National Animal Research Authority (project license no FOTS 6809/14) and/or the Ethics Committee on Animal Care and Use in Gothenburg and Stockholm, Sweden.
The animal experiments were performed in accordance with the European Directive 2010/63/EU and The Guide for the Care and Use of Laboratory Animals, 8th edition (NRC 2011, National Academic Press). All mice had ad libitum access to water and standard rodent diet.
Tissue collection and extraction of primary lymphocytes from liver
Mice at the indicated age were sacrificed and weight of the mice and weight of the liver, spleen and cecum were registered. Dilatation of the common bile duct (CBDD) was measured. Collection of blood, serum, liver tissue, and extraction of primary lymphocytes from perfused livers was also performed as described in the Supplementary Material. Cecal content and mucosal
samples were taken from the cecum with sterile equipment, and immediately snap-frozen in liquid nitrogen and later stored at -80°C until DNA extraction.
DNA extraction
DNA from cecal content or 15-20 mm of cecal tissue was extracted as previously described [18], and a more detailed description included in the Supplementary Material.
Library preparations, sequencing and bioinformatic processing
Library preparations and 16S rRNA sequencing of the V4 region were
performed at BGI (Shenzhen, China), on the Illumina MiSeq platform (San Diego, CA, USA). The Quantitative Insights Into Microbial Ecology (QIIME) platform (version 1.8.0) [19], was used for further bioinformatic processing using closed-reference operational taxonomic unit (OTU) mapping to the Greengenes database [20]. Detailed methods are included in the
Supplementary Material.
RNA isolation, reverse transcription and quantitative real-time PCR Total RNA from snap-frozen liver tissue was isolated, and reverse
transcription and quantitative real-time PCR was performed as described in the Supplementary Material. Detailed primer information is provided in Supplementary Table 1.The relative expression of each sample was first normalised to the expression of the reference gene (beta-actin (Actb)), and then normalised to the average expression in samples from CONV-R
NOD.c3c4 mice, and the data were analysed according to the 2-DDCT method.
Flow cytometry
Following preparation of single-cell suspensions, the cells were incubated with anti-mouse CD16/32 clone 93 (BioLegend, San Diego, CA, USA) for blocking of Fc-receptors to avoid non-specific binding. Lymphocytes were stained with FITC anti-mouse TCRb, clone H57-597 (BD Biosciences, Franklin Lakes, NJ, USA) for an hour. Flow cytometric analysis was performed using a BD FACS Verse flow cytometer (BD Biosciences). The results were analysed in FlowJo version 9.5.3 (TreeStar, Ashland, OR, USA). Detailed anti-body information is
Histology and scoring
Liver tissue and snap frozen cecal tissue were fixed in 4% formalin in room temperature, embedded in paraffin, sectioned and stained with hematoxylin and eosin (H&E), or Sirius red staining, and scored in a blinded fashion (Supplementary Fig. 1). Detailed methods are included in the
Supplementary Material.
Immunohistochemistry
Immunohistochemical staining of CD3 (T cell marker), Ly6G (neutrophil marker), α-smooth muscle actin (α-SMA, myofibroblast marker) and Mac-2 (macrophage marker) was performed as described in the Supplementary Material, and detailed anti-body information is stated in Supplementary Table 2.
Biochemistry
Alanine transaminase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP) were measured in serum using a ADVIA 1800 (Siemens, Munich, Germany) at The Central Laboratory, Norwegian School of Veterinary Science (Oslo, Norway).
Statistical analysis
Unless stated otherwise all values are presented as means ± SEM. Statistical significance was calculated with unpaired Student's t-test for variables
meeting requirements of normal distribution or Mann-Whitney U test for
variable not meeting the requirements for normal distribution using GraphPad Prism version 5.0 b (GraphPad Software, La Jolla, CA). Statistical analyses on relative taxa abundances were done using the R statistical software environment (version 3.1.2, https://www.R-project.org/), using the Mann- Whitney U test, and calculations based on beta diversity (unweighted UniFrac) was done using the anosim function in QIIME (version 1.8.0).
Relative abundance ratios were calculated by dividing the mean relative abundance of each bacterial taxon in each category.
RESULTS
Bacterial communities in NOD.c3c4 and NOD mice
We first explored differences in the gut microbiota of mice with and without biliary inflammation by comparing the microbial profiles in the cecal mucosa and cecal content of NOD and NOD.c3c4 mice at 10 weeks of age (n = 4-5 in each group). The experiments were performed before the onset of diabetes in the NOD mice (Supplementary Table 3). The gut microbiota in NOD.c3c4 and NOD control mice showed marked difference in their total bacterial community, both in the cecal content and mucosa (Fig. 1A), and the phenotype of the mice explained 41.2% of the variation of the bacterial community in the cecal content. To further explore whether these differences could be replicated in another environment and to rule out potential cage effects, NOD and NOD.c3c4 mice were rederived into a new MDU facility by caesarean section. The extent of the global differences in both mucosa and cecal content was similar in the new facility (Fig. 1B). Bacterial diversity and richness were not different in the two strains in any of the experiments (Fig.
1C). At the genus-level, the abundances of multiple bacterial taxa were significantly different between the NOD.c3c4 and NOD mice, both in cecal content (p <0.05, Table 1) and mucosa (p <0.05, Supplementary Table 4), in both experiments.
Severity of biliary disease is attenuated in germ free NOD.c3c4 mice
To evaluate the impact of the intestinal microbiota on the biliary disease in NOD.c3c4 mice, we rederived the NOD.c3c4 mice that had been rederived
into a new MDU facility (hereafter denoted CONV-R NOD.c3c4) into a GF facility (germ free animals denoted GF NOD.c3c4).
The body weight of GF NOD.c3c4 mice (n = 9-11) was reduced compared with the weight of CONV-R NOD.c3c4 mice (n = 9-11) (Fig. 2A) at 9 and 18 weeks of age. The livers of 9 and 18 weeks old GF NOD.c3c4 mice weighed significantly less than the livers of age- and gender-matched CONV-R
NOD.c3c4 mice, both in absolute numbers (Supplementary Fig. 2A), and as percentage of body weight (Fig. 2B). To explore whether this was a general phenomenon in the NOD mouse strain we compared liver weights of NOD mice raised in a GF and a conventional facility (n = 5-9 in each group). The decrease in liver weight seen in GF NOD.c3c4 was present to a lesser degree in GF NOD mice (Fig. 2C, Supplementary Fig. 2B) pointing to a phenotypic specific effect in NOD.c3c4 mice. The extra-hepatic bile duct dilatation seen in 9 weeks old NOD.c3c4 was significantly reduced in GF NOD.c3c4 mice (p = 0.0043, Fig. 2D) and a similar trend was seen in 18 weeks old mice (p = 0.13, Fig. 2D). There was no recovery of a more normal phenotype in the CONV-R animals at 18 weeks as compared to 9 weeks (data not shown). No extra- hepatic bile duct dilatation was detected in NOD control mice (data not shown).
At 18 weeks of age the biliary inflammation was more pronounced in CONV-R NOD.c3c4 mice and CONV-R NOD.c3c4 mice displayed significantly larger infiltrates around the intrahepatic bile ducts than GF mice at this age (p = 0.014, Fig. 3A and B). The percentages of T cells in livers of conventionally raised NOD and NOD.c3c4 mice were similar (Supplementary Fig. 3, [1]), so
to further assess the disease we evaluated histology and the biliary infiltrates.
We further investigated the portal infiltrates and demonstrated that CONV-R NOD.c3c4 mice had a higher count of CD3, Ly6G and Mac-2 positive cells around their bile ducts at 18 weeks of age compared with GF NOD.c3c4 mice (Fig. 4A). At 9 weeks of age we observed a tendency towards larger portal infiltrates and a significantly higher count of Ly6G positive cells around the bile ducts of CONV-R NOD.c3c4 mice compared to GF mice (Supplementary Fig. 4A and B). The 9 and 18 weeks old CONV-R NOD.c3c4 mice also
exhibited a tendency to larger biliary infarcts (Fig. 3A and B, Supplementary Fig. 4A and B). A trend towards lower ALT serum levels was demonstrated in the GF NOD.c3c4 mice compared with CONV-R mice at 9 and 18 weeks of age (Supplementary Fig. 5A). In contrast, AST and ALP values were more elevated in the GF NOD.c3c4 mice in both age groups (Supplementary Fig.
5B and C). As expected, the spleen of GF NOD.c3c4 mice weighed less, while their cecum was enlarged and weighed significantly more, than those of CONV-R mice (Supplementary Fig. 5D). We were unable to detect any difference in the degree of liver fibrosis in GF and CONV-R NOD.c3c4 mice (Supplementary Fig. 6). There were no signs of inflammation in cecal tissue of neither CONV-R nor GF NOD.c3c4 mice (Supplementary Fig. 7).
The biliary phenotype of NOD.c3c4 mice is not transmissible
To explore whether it was possible to transmit the biliary disease phenotype of NOD.c3c4 mice to the NOD control mice, we co-housed NOD.c3c4 mice and NOD control mice for four weeks from weaning (four weeks of age). We were unable to identify a transmittable phenotype, and NOD.c3c4 co-housed
with NOD control mice developed biliary disease to the same degree as NOD.c3c4 mice housed with their litter mates (Supplementary Fig. 8).
Antibiotics affects the liver phenotype in NOD.c3c4 mice
Given the amelioration of biliary disease observed in GF NOD.c3c4 mice, we hypothesised that treatment with non-absorbable antibiotics from weaning would protect the CONV NOD.c3c4 mice against the biliary phenotype.
Similar to GF NOD.c3c4 mice NOD.c3c4 mice treated with antibiotics had livers that weighed significantly less than the livers of age- and gender- matched control NOD.c3c4 mice and a tendency to lower ALT levels in their serum (Fig. 5A and 5C), but there was no difference in CBDD between
antibiotic treated and control mice (Fig. 5B). Antibiotic treated NOD.c3c4 mice had less biliary infarcts compared to control NOD.c3c4, but no difference was observed in other histological parameters such as portal inflammation (Fig.
5D).
DISCUSSION
In the present study we demonstrate that there are clear differences in the gut microbiota in NOD.c3c4 mice with biliary disease and NOD control mice.
Furthermore, when raised in a GF environment, NOD.c3c4 mice develop less biliary disease compared with CONV-R NOD.c3c4 mice. Likewise, treatment with non-absorbable antibiotics in NOD.c3c4 mice partially dampens the liver phenotype. Our findings implicate the gut microbiota as a contributor to biliary disease in the NOD.c3c4 mouse model.
We observed distinct differences in the global bacterial community between mice with and without biliary disease. The results represent a parallel to the human biliary disease, where the gut microbiota of both stool and mucosa is characterised by distinct differences from healthy individuals [11–14].
Differences in gut microbiota have not been well explored in other human biliary diseases than PSC or murine models of biliary inflammation, but induction of cholestasis in mice by means of bile duct ligation, does not seem to alter either global bacterial composition or diversity [21]. This could indicate that the differences in bacterial composition demonstrated develop at an earlier time point in life and that a later induction of cholestasis will not
contribute to a global shift in the microbiota. To rule out potential cage effects as far as possible, the mice were rederived into a new conventional animal facility. Although we cannot formally rule out that new cage effects can establish after rederivation, we consider it as unlikely that the differences observed are driven by cage effects as the differences in global bacterial communities were demonstrated in two different environments. The use of
NOD mice as controls could be challenging as NOD mice develop diabetes and this can potentially affect the microbiota [22], but the NOD mice used in the present analysis of gut microbial profiles were harvested before the development of diabetes as confirmed by blood glucose measurements.
Following the identification of differences in the bacterial communities we hypothesised that GF NOD.c3c4 would have an altered biliary phenotype.
Indeed, the GF NOD.c3c4 mice were protected from biliary disease in terms of several clinical and pathological features. The common bile duct dilatation was less pronounced in GF NOD.c3c4 mice and we demonstrated the development of larger portal infiltrates and higher counts of CD3, Ly6G and Mac-2 positive cells around the bile ducts of CONV-R mice. Several factors could potentially contribute to the observed differences in biliary phenotype of CONV-R and GF mice. First of all, the total amount of bile acids is reduced in feces and serum of GF mice, and the composition of bile acids vary greatly between GF and CONV-R mice, also in the liver [23]. Secondly, the immune system and lymphocyte populations of GF mice are also known to be altered with mucosal accumulation of natural killer T cells and absence of mucosal associated invariant T cells in GF mice [24,25]. This likely can affect an inflammatory disease phenotype, nevertheless, it is striking that several components of the biliary inflammation are altered in a GF environment. In line with the observation in GF animals, treatment of NOD.c3c4 mice with non-absorbable antibiotics after weaning resulted in reduced liver weight and less biliary infarcts. Although using antibiotics to deplete the microbiota constitutes a less controlled situation than using GF animals, there is no
antibiotics [26]. Since co-housing of animals has been shown to affect the development of non-alcoholic fatty liver disease (NAFLD) [27] and colitis [28]
in other animal models, we investigated whether this was the case for the biliary phenotype of NOD.c3c4 mice. These experiments clearly demonstrated no sign of transmissibility or protection from biliary disease. Taken together the results from the GF, antibiotics and co-housing experiments indicate that the majority of effects of the microbiota is initiated before weaning during the time when the host immune system is developed and tolerance to
environmental exposures is achieved [29].
Another murine model of PSC is the Mdr2-/- mouse. In contrast to our findings, a recent study by Tabibian et al. [16] demonstrated that GF Mdr2-/- mice developed more severe liver disease measured by ALP, AST and bilirubin in serum, as well as more severe fibrosis compared with CONV-R Mdr2-/- mice.
Aggravation of liver fibrosis is also seen in thioacetamide and carbon
tetrachloride (CCl4)treated GF mice compared with thioacetamide - and CCl4- treated CONV-R mice [30], while in models of acute hepatic injury such as acetaminophen- and alcohol-induced hepatotoxicity mice raised in GF facilities seem to be protected from hepatic disease [31,32]. In NOD.c3c4 mice a minimal degree of fibrosis is seen, and this could suggest that liver disease models that are more driven by fibrosis develop an aggravated phenotype in the absence of commensal bacteria, while the liver disease of other murine models, displaying features of lipid accumulation or portal inflammation, is ameliorated in a germ free environment.
Our histological analysis and measurements of CBDD demonstrated an ameliorated phenotype in GF NOD.c3c4 mice, and there was a trend towards lower levels of the liver specific enzyme ALT in GF mice. ALP and AST serum levels on the contrary were elevated in GF mice. The use of ALP serum levels as a marker of biliary disease in mice has been somewhat debated [33,34] as the ALP levels measured in mice seem to be mostly bone-derived ALP
isoforms, some intestinal ALP isoforms and close to no liver ALP, and it also varies between different mouse strains [35]. Intestinal ALP activity is
increased in GF mice [36] and this could explain some of the discrepancies seen in our serum measurements.
In conclusion, we have demonstrated that there are distinct differences in the gut microbiota between mice with and without biliary disease, and that the biliary disease of NOD.c3c4 mice is reduced in a germ free environment and affected by non-absorbable antibiotics. This indicates that commensal
bacteria can contribute to biliary inflammation.
ACKNOWLEDGEMENTS
The authors wish to thank Anne Pharo, Eva Kristine Klemsdal Henriksen, Tonje Bjørnetrø, Hege Dahlen Sollid and Liv Wenche Thorbjørnsen at NoPSC Research Center, Aurelija Abraityte at the Research Institute for Internal Medicine, and Hege G. Russnes and Ellen Hellesylt at Department of
Pathology, Oslo University Hospital, for great assistance and technical help.
We also wish to thank Johanna Aspsäter at Department of Microbiology, Karolinska Institutet, Stockholm for help with our germ free mouse colony. We are grateful to Prof Erik Schrumpf for critical reading of our manuscript and to Prof Tore Midtvedt for valuable input on our project.
REFERENCES
Author names in bold designate shared co-first authorship.
[1] Irie J, Wu Y, Wicker LS, Rainbow D, Nalesnik MA, Hirsch R, et al.
NOD.c3c4 congenic mice develop autoimmune biliary disease that serologically and pathogenetically models human primary biliary cirrhosis. J Exp Med 2006;203:1209–1219.
[2] Koarada S, Wu Y, Fertig N, Sass DA, Nalesnik M, Todd JA, et al.
Genetic control of autoimmunity: protection from diabetes, but spontaneous autoimmune biliary disease in a nonobese diabetic congenic strain. J Immunol 2004;173:2315–2323.
[3] Folseraas T, Liaskou E, Anderson CA, Karlsen TH. Genetics in PSC:
what do the “risk genes” teach us? Clin Rev Allergy Immunol 2015;48:154–164.
[4] Anderson MS, Bluestone JA. The NOD mouse: a model of immune dysregulation. Annu Rev Immunol 2005;23:447–485.
[5] Chuang Y-H, Ridgway WM, Ueno Y, Gershwin ME. Animal models of primary biliary cirrhosis. Clin Liver Dis 2008;12:333–347.
[6] Pollheimer MJ, Fickert P. Animal models in primary biliary cirrhosis and primary sclerosing cholangitis. Clin Rev Allergy Immunol 2015;48:207–
217.
[7] Trivedi PJ, Adams DH. Mucosal immunity in liver autoimmunity: a comprehensive review. J Autoimmun 2013;46:97–111.
[8] Kummen M, Schrumpf E, Boberg KM. Liver abnormalities in bowel diseases. Best Pract Res Clin Gastroenterol 2013;27:531–542.
[9] Lichtman SN, Keku J, Clark RL, Schwab JH, Sartor RB. Biliary tract disease in rats with experimental small bowel bacterial overgrowth.
Hepatology 1991;13:766–772.
[10] Lichtman SN, Sartor RB, Keku J, Schwab JH. Hepatic inflammation in rats with experimental small intestinal bacterial overgrowth.
Gastroenterology 1990;98:414–423.
[11] Rühlemann MC, Heinsen F-A, Zenouzi R, Lieb W, Franke A, Schramm C. Faecal microbiota profiles as diagnostic biomarkers in primary
sclerosing cholangitis. Gut 2016 (Epub ahead of print).
doi:10.1136/gutjnl-2016-312180
[12] Sabino J, Vieira-Silva S, Machiels K, Joossens M, Falony G, Ballet V, et al. Primary sclerosing cholangitis is characterised by intestinal dysbiosis independent from IBD. Gut 2016 (Epub ahead of print).
doi:10.1136/gutjnl-2015-311004
[13] Kummen M, Holm K, Anmarkrud JA, Nygård S, Vesterhus M, Høivik ML, et al. The gut microbial profile in patients with primary sclerosing cholangitis is distinct from patients with ulcerative colitis without biliary disease and healthy controls. Gut 2016 (Epub ahead of print).
doi:10.1136/gutjnl-2015-310500
[14] Quraishi MN, Sergeant M, Kay G, Iqbal T, Chan J, Constantinidou C, et al. The gut-adherent microbiota of PSC-IBD is distinct to that of IBD.
Gut 2016 (Epub ahead of print). doi:10.1136/gutjnl-2016-311915
[15] Tabibian JH, Weeding E, Jorgensen RA, Petz JL, Keach JC, Talwalkar JA, et al. Randomised clinical trial: vancomycin or metronidazole in patients with primary sclerosing cholangitis - a pilot study. Aliment
Pharmacol Ther 2013;37:604–612.
[16] Tabibian JH, O’Hara SP, Trussoni CE, Tietz PS, Splinter PL, Mounajjed T, et al. Absence of the intestinal microbiota exacerbates hepatobiliary disease in a murine model of primary sclerosing
cholangitis. Hepatology 2016;63:185–196.
[17] Fickert P, Fuchsbichler A, Wagner M, Zollner G, Kaser A, Tilg H, et al.
Regurgitation of bile acids from leaky bile ducts causes sclerosing cholangitis in Mdr2 (Abcb4) knockout mice. Gastroenterology 2004;127:261–274.
[18] Uronis JM, Arthur JC, Keku T, Fodor A, Carroll IM, Cruz ML, et al. Gut microbial diversity is reduced by the probiotic VSL#3 and correlates with decreased TNBS-induced colitis. Inflamm Bowel Dis 2011;17:289–297.
[19] Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME allows analysis of high- throughput community sequencing data. Nat Methods 2010;7:335–336.
[20] DeSantis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL, Keller K, et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol 2006;72:5069–
5072.
[21] Fouts DE, Torralba M, Nelson KE, Brenner DA, Schnabl B. Bacterial translocation and changes in the intestinal microbiome in mouse models of liver disease. J Hepatol 2012;56:1283–1292.
[22] Wen L, Ley RE, Volchkov PY, Stranges PB, Avanesyan L,
Stonebraker AC, et al. Innate immunity and intestinal microbiota in the development of Type 1 diabetes. Nature 2008;455:1109–1113.
[23] Sayin SI, Wahlström A, Felin J, Jäntti S, Marschall H-U, Bamberg K, et al. Gut microbiota regulates bile acid metabolism by reducing the levels of tauro-beta-muricholic acid, a naturally occurring FXR antagonist. Cell Metab 2013;17:225–235.
[24] Olszak T, An D, Zeissig S, Vera MP, Richter J, Franke A, et al.
Microbial exposure during early life has persistent effects on natural killer T cell function. Science 2012;336:489–493.
[25] Treiner E, Duban L, Bahram S, Radosavljevic M, Wanner V, Tilloy F, et al. Selection of evolutionarily conserved mucosal-associated invariant T cells by MR1. Nature 2003;422:164–169.
[26] Lundberg R, Toft MF, August B, Hansen AK, Hansen CHF. Antibiotic- treated versus germ-free rodents for microbiota transplantation studies.
Gut Microbes 2016;7:68–74.
[27] Henao-Mejia J, Elinav E, Jin C, Hao L, Mehal WZ, Strowig T, et al.
Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity. Nature 2012;482:179–185.
[28] Elinav E, Strowig T, Kau AL, Henao-Mejia J, Thaiss CA, Booth CJ, et al. NLRP6 inflammasome regulates colonic microbial ecology and risk for colitis. Cell 2011;145:745–757.
[29] Gensollen T, Iyer SS, Kasper DL, Blumberg RS. How colonization by microbiota in early life shapes the immune system. Science
2016;352:539–544.
[30] Mazagova M, Wang L, Anfora AT, Wissmueller M, Lesley SA, Miyamoto Y, et al. Commensal microbiota is hepatoprotective and prevents liver fibrosis in mice. FASEB J 2015;29:1043–1055.
[31] Possamai LA, McPhail MJ, Khamri W, Wu B, Concas D, Harrison M, et al. The role of intestinal microbiota in murine models of acetaminophen- induced hepatotoxicity. Liver Int 2015;35:764–773.
[32] Canesso MCC, Lacerda NL, Ferreira CM, Gonçalves JL, Almeida D, Gamba C, et al. Comparing the effects of acute alcohol consumption in germ-free and conventional mice: the role of the gut microbiota. BMC Microbiol 2014;14:240.
[33] Krones E, Erwa W, Trauner M, Fickert P. Serum alkaline phosphatase levels accurately reflect cholestasis in mice. Hepatology 2015;62:981–
983.
[34] Trivedi PJ, Weston CJ, Webb GJ, Newsome PN, Hirschfield GM, Adams DH. Serum alkaline phosphatase in multidrug resistance 2 (Mdr2-/-) knockout mice is strain specific. Hepatology 2016;63:346.
[35] Halling Linder C, Englund UH, Narisawa S, Millán JL, Magnusson P.
Isozyme profile and tissue-origin of alkaline phosphatases in mouse serum. Bone 2013;53:399–408.
[36] Yolton DP, Stanley C, Savage DC. Influence of the indigenous gastrointestinal microbial flora on duodenal alkaline phosphatase activity in mice. Infect Immun 1971;3:768–773.
TABLES
Table 1. Bacterial taxa that differ between NOD.c3c4 and control mice in cecal content. In the first experiment (“Before rederivation”), several taxa on the genus level were different between NOD.c3c4 and control mice in cecal content. To examine these results in a new environment and rule out potential cage effects, we rederived the mice into another conventional animal facility, and again identified differentiating genera between the phenotypes. Data analysed using Mann-Whitney U test. Relative abundance ratios were
calculated by dividing the mean relative abundance of each bacterial taxon in each category. Significant values (p <0.05) in bold.
Taxa enriched in NOD.c3c4 mice
Before rederivation After rederivation into another conventional
animal facility
Order Family Genus
Relative abundance ratio
NOD.c3c4/NOD p-value
Relative abundance ratio
NOD.c3c4/NOD p-value
Bacteroidales S24.7 [unknown] 0.57 0.032 0.64 0.41
Clostridiales Ruminococcaceae Oscillospira 1.92 0.032 1.04 0.90
Clostridiales Christensenellaceae [unknown] 3.39 0.016 1.13 0.56
Erysipelotrichales Erysipelotrichaceae Allobaculum 0.01 0.016 1.77 0.81 Anaeroplasmatales Anaeroplasmataceae Anaeroplasma 6.57 0.016 3.08 0.73
YS2 [unknown] [unknown] 2212.32 0.011 5.93 0.23
Deferribacterales Deferribacteraceae Mucispirillum 0.04 0.011 1.23 0.73
Gemellaceae Gemellaceae [unknown] 84.21 0.011 3.00 1.00
Clostridiales Lachnospiraceae Anaerostipes 0.00 0.0097 4.77 0.35
Clostridiales Lachnospiraceae Coprococcus 0.22 0.0079 0.66 0.90
Clostridiales Ruminococcaceae [unknown] 2.11 0.0079 1.21 0.29
Clostridiales Ruminococcaceae Ruminococcus 5.95 0.0079 1.05 1.00
Clostridiales Mogibacteriaceae [unknown] 0.47 0.0079 0.97 1.00
Verrucomicrobiales Verrucomicrobiaceae Akkermansia 1281.86 0.0079 1.79 0.37
Clostridiales Clostridiaceae Clostridium 2.07 0.46 33.93 0.020
Bacteroidales Porphyromonadaceae Parabacteroides 0.42 0.66 0.47 0.032
Clostridiales Lachnospiraceae Dorea 1.06 0.84 5.40 0.032
Burkholderiales Burkholderiaceae Burkholderia 0.92 1.00 0.00 0.042
FIGURE LEGENDS
Fig. 1. NOD.c3c4 mice have a distinct global bacterial composition compared with NOD control mice. Principal coordinate plot based on
unweighted UniFrac distances illustrating separation of the NOD (n = 4-5) and NOD.c3c4 mice (n = 5) in cecal content and mucosa (A) before (p <0.01) and (B) after rederivation into another conventional animal facility (p <0.02). (C) Intra-individual diversity measured by Shannon Diversity Index in cecal content of NOD (n = 4-5) and NOD.c3c4 mice (n = 5) was similar. Data in (A) and (B) compared using the anosim function in QIIME. Data in (C) are
presented as mean ± SEM, unpaired Student's t-test used for comparison.
Fig. 2. Germ free (GF) NOD.c3c4 mice have lower liver weight and less distended common bile ducts than conventionally raised (CONV-R) NOD.c3c4 mice. (A) Total body weight and (B) liver weight as percentage of body weight of CONV-R and GF NOD.c3c4 mice at 9 (n = 9 in each group) and 18 weeks (w) of age (n = 11 in each group). (C) Liver weight as
percentage of body weight of CONV-R and GF NOD mice at 9 (GF: n = 9, CONV-R: n = 5) and 18 w of age (GF: n = 4, CONV-R: n = 5). (D) Log- transformed common bile duct dilatation (CBDD) of CONV-R and GF NOD.c3c4 mice at 9 (n = 9 in each group) and 18 w of age (n = 11 in each group). Data are presented as mean ± SEM, unpaired Student's t-test used for comparison. *p <0.05, **p <0.01, ***p <0.001.
Fig. 3. Germ free (GF) NOD.c3c4 mice have reduced inflammatory portal infiltrates compared with conventionally raised (CONV-R) NOD.c3c4 mice at 18 weeks of age. (A) H&E (40X) and Sirius red stained sections (40X, 10X) illustrating portal inflammation, bile infarcts and fibrosis. (B) Liver pathology in GF (n = 11) and CONV-R (n = 11) NOD.c3c4 mice scored on parameters portal inflammation, bile infarcts, fibrosis and dilatation of
intrahepatic bile ducts (IHBD). Data are presented as mean ± SEM, unpaired Student's t-test used for comparison. *p <0.05.
Fig. 4. Germ free (GF) NOD.c3c4 mice have less CD3, Ly6G and Mac-2 positive cells around their bile ducts compared with conventionally raised (CONV-R) NOD.c3c4 mice. (A) CD3, Ly6G and Mac-2 positive cells around bile ducts (indicated by arrows) in 18 weeks old CONV-R (n = 11) and GF (n = 11) NOD.c3c4 mice (40X). (B) Mean CD3/ Ly6G/ Mac-2 positive cell count from 6 different areas with bile ducts of CONV-R and GF NOD.c3c4 mice. CD3, Ly6G and Mac-2 are makers of T cells, neutrophils and
macrophages, respectively. Data are presented as mean ± SEM, for CD3+ count unpaired Student's t-test used, for Ly6G+ and Mac-2+ count Mann- Whitney U test for used for comparison due to a non-normal data distribution.
*p <0.05, ***p <0.001.
Fig. 5. Antibiotic treated (AB) NOD.c3c4 mice have lower liver weight and less biliary infarcts compared with NOD.c3c4 mice receiving normal drinking water (control). (A) Liver weight as percentage of body weight of AB NOD.c3c4 (n = 19) and control NOD.c3c4 (n = 19) mice. AB NOD.c3c4 mice received treatment for 4 weeks from weaning. (B) Log-transformed common bile duct dilatation (CBDD) and (C) alanine transaminase (ALT) levels measured in serum of AB and control NOD.c3c4 mice. (D) Liver
pathology scored on parameters portal inflammation, bile infarcts, fibrosis and dilatation of intrahepatic bile ducts (IHBD). The data represents results from two pooled, independent experiments. Data are presented as mean ± SEM, unpaired Student's t-test used for comparison. *p <0.05, ***p <0.001.
FIGURES Fig. 1.
Fig. 2.
Fig. 3.
Fig. 4.
Fig. 5.
THE GUT MICROBIOTA CONTRIBUTES TO DISEASE IN A MOUSE MODEL WITH SPONTANEOUS BILE DUCT INFLAMMATION
Elisabeth Schrumpf1,2,3,*, Martin Kummen1,2,3,*, Laura Valestrand1,2,3,4, Thomas U. Greiner5, Kristian Holm1,2,3, Velmurugesan Arulampalam6, Henrik M.
Reims7, John Baines8,9, Fredrik Bäckhed5, Tom H. Karlsen1,2,3,4,Richard S.
Blumberg10, Johannes R. Hov1,2,3,4, Espen Melum1,2,3,4.
1Norwegian PSC Research Center, Division of Surgery, Inflammatory
Medicine and Transplantation, Oslo University Hospital, Rikshospitalet, Oslo, Norway. 2K.G. Jebsen Inflammation Research Centre and Institute of Clinical Medicine, University of Oslo, Oslo, Norway. 3Research Institute of Internal Medicine, Division of Surgery, Inflammatory Medicine and Transplantation, Oslo University Hospital, Rikshospitalet, Oslo, Norway. 4Section of
Gastroenterology, Division of Surgery, Inflammatory Medicine and Transplantation, Surgery, and Transplantation, Oslo University Hospital, Rikshospitalet, Oslo, Norway. 5The Wallenberg Laboratory and Sahlgrenska Center for Cardiovascular and Metabolic Research, Department of Molecular and Clinical Medicine, Institute of Medicine, University of Gothenburg,
Gothenburg, Sweden. 6Core Facility for Germfree Research (CFGR),
Department of Comparative Medicine and Department of Microbiology, Tumor and Cell Biology (MTC), Karolinska Institutet, Stockholm, Sweden.
7Department of Pathology, Oslo University Hospital, Rikshospitalet, Oslo, Norway. 8Max Planck Institute for Evolutionary Biology, Plön, Germany.
9Institute for Experimental Medicine, Christian-Albrechts-University of Kiel, Kiel, Germany. 10Division of Gastroenterology, Hepatology and Endoscopy, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA. *Shared first authorship.
Supplementary methods... 3
Tissue collection and extraction of primary lymphocytes from liver ... 3
DNA extraction ... 3
Library preparations and sequencing ... 4
Bioinformatic processing ... 4
RNA isolation, reverse transcription and quantitative real-time PCR (qPCR) ... 5
Histology and scoring ... 6
Immunohistochemistry ... 7
Supplementary tables ... 9
Supplementary Table 1 ... 9
Supplementary Table 2 ... 10
Supplementary Table 3 ... 11
Supplementary Table 4 ... 12
Supplementary figures ... 13
Supplementary Fig. 1 ... 13
Supplementary Fig. 2 ... 14
Supplementary Fig. 3 ... 15
Supplementary Fig. 4 ... 16
Supplementary Fig. 5 ... 17
Supplementary Fig. 6 ... 18
Supplementary Fig. 7 ... 19
Supplementary Fig. 8 ... 20
References ... 21
Tissue collection and extraction of primary lymphocytes from liver
Blood was collected from the heart, left in room temperature for 1/2 - 1 hour and centrifuged at 12 000 RPM, 4°C for 10 minutes. The serum was collected and kept at -80°C. Non-fasting blood glucose was measured with Accu-Chek Performa (Roche Diagnostics, Basel, Switzerland). Cecal content and
mucosal samples were taken from the cecum with sterile equipment, and immediately snap-frozen in liquid nitrogen and later stored at -80°C until DNA extraction. Liver tissue and snap-frozen sections of cecal mucosa were fixed in 4% formalin and embedded in paraffin. Macrodissected liver tissue for RNA extraction was immediately snap-frozen in liquid nitrogen, and stored at -80°C until further processing. For extraction of primary lymphocytes from liver, the liver was perfused with 4 to 10 mL cold PBS, harvested, passed through a 70 um nylon mesh and washed two times [1]. The cell suspension was overlaid on a 40%/60% Percoll® (Sigma-Aldrich, St.Louis, MO, USA) density gradient, centrifuged at 700 g for 20 minutes at 4°C (without brakes) and the
lymphocyte layer was collected and washed.
DNA extraction
DNA from cecal content or 15-20 mm of cecal tissue was extracted as previously described [2]. In short, samples were resuspended in lysis buffer containing 20 mg/mL lysozyme (Sigma-Aldrich) and incubated at 37°C for 30 minutes. Sodium dodecyl sulphate (10%, Sigma-Aldrich) and proteinase K (20
bead beater (BioSpec Products, Bartlesville, OK, USA) and 0.1 mm zirconia/silica beads mix (BioSpec Products). Finally, samples were processed with DNeasy mini DNA extraction kit (Qiagen).
Library preparations and sequencing
Library preparations and sequencing were performed at BGI (Shenzhen, China). The V4 region of the prokaryotic 16S rRNA gene was amplified using dual-indexing primers, 515F (5’-GTGCCAGCMGCCGCGGTAA-3’) and 806R (5’-GGACTACHVGGGTWTCTAAT-3’) and Phusion High-Fidelity PCR Master Mix (NEB, Ipswich, MA, USA). Polymerase chain reaction (PCR) products were purified with Agencourt AMPure XP (Beckman Coulter, Brea, CA, USA).
Average molecule length in the final library was determined using Agilent 2100 bioanalyzer and Agilent DNA 1000 reagents (Agilent Technologies, Santa Clara, CA, USA), and libraries were finally submitted to sequencing on the Illumina MiSeq platform (San Diego, CA, USA) using the MiSeq Reagent Kits v2.
Bioinformatic processing
Pair-end raw reads from the Illumina platform were overlapped and merged using FLASH 1.2.10 with standard parameters [3]. Quality control of the merged reads were performed using the Quantitative Insights Into Microbial Ecology (QIIME) platform (version 1.8.0) [4], using a Phred quality score cut-
similarity using closed-reference operational taxonomic unit (OTU) mapping in QIIME. Calculations of rarefied alpha diversity (Shannon Diversity Index) and beta diversity (unweighted UniFrac) were done in QIIME. OTUs represented in only one single sample in one sample site in each experiment were
discarded to reduce the number of comparisons. OTUs (mapping to the mitochondria family and chloroplast class) misclassified in Greengenes to the Bacteria-kingdom were removed.
RNA isolation, reverse transcription and quantitative real-time PCR (qPCR)
Total RNA from ~25mg of snap-frozen liver tissue was isolated using AllPrep DNA/RNA Mini Kit (Qiagen) with a RNase-Free DNase Set (Qiagen)
according to the instructions of the manufacturer, and spectrophotometrically quantified with NanoDrop (Thermo Scientific, Wilmington, DE, USA). Reverse transcription was performed using 1000ng, 250ng or 200ng of RNA and the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) according to the instructions of the manufacturer. Ten µl qPCR reactions containing SYBR Green PCR Master Mix (Applied Biosystems), 3.75 pmol of each primer and an estimated 6.25ng of
complementary DNA (cDNA) were set up using an epMotion 5070 pipetting robot (Eppendorf, Selangor, Malaysia), with each sample in triplicates on 384- well plates (Sarstedt, Numbrecht, Germany). Primers for the following genes were used: collagen 3a1 (Col3a1), collagen 1a1 (Col1a1), matrix
metalloproteinase 2 (Mmp2) and tissue inhibitor of metalloproteinases 1
expression of each sample was first normalised to the expression of the reference gene (Actb), and then normalised to the average expression in samples from CONV-R NOD.c3c4 mice, and the data were analysed according to the 2-DDCT method.
Histology and scoring
For H&E staining sections (3 µm) of formalin-fixed paraffin-embedded murine liver and cecal mucosal tissue were deparaffinised. Deparaffinised tissue was then stained for 6 minutes with Hematoxylin. Sections were then rinsed in water, put in ammonia water, rinsed in water for another 5 minutes and stained for 1 minute with Eosin. The sections were dehydrated in ethanol, cleared in xylene and mounted. For Sirius red staining sections were deparaffinized and stained with Picro Sirius Red solution 0.1% (Histolab Products AB, Gothenburg, Sweden) for one hour. The sections were then washed in acidified water, dehydrated in 100% ethanol, cleared in xylene and mounted. The sections were scored in a blinded fashion on the following parameters: portal inflammation (0-3), dilatations of intrahepatic bile ducts (0- 3), fibrosis (0-3) and bile infarcts (0-2), where a score of 0 indicates no pathology (Supplementary Fig. 1). Images were generated from an Eclipse E400 Microscope (Nikon, Tokyo, Japan) with a DS-Fi1 camera (Nikon) controlled by NIS-elements BR 3.1 software (Nikon).
Immunohistochemistry staining of CD3 (T cell marker), Ly6G (neutrophil marker), α-smooth muscle actin (α-SMA) (myofibroblast marker) and Mac-2 (macrophage marker) was performed. Detailed anti-body information is stated in Supplementary Table 2. Sections (3 µm) of formalin-fixed paraffin-
embedded liver tissue were deparaffinised before antigen retrieval. Samples were boiled at 100oC for 20 minutes in a 10 mM Citrate buffer pH 6 before blocking for 20 minutes with 3% H2O2 (0.3% H2O2 for CD3 staining). Then 20 minutes blocking was performed with 2.5% Ready-to-use normal horse serum (Vector Laboratories, Burlingame, CA, USA) (CD3), 2.5% Ready-to-use normal goat serum (Vector Laboratories) (Ly6G) or 0,5% BSA/0,1 % Tween 20 (Sigma-Aldrich) (α-SMA and Mac-2). The samples were incubated with the following primary antibodies for 60 minutes in room temperature: anti-CD3 rabbit monoclonal, clone SP7 (Abcam, Cambridge, UK), anti-Ly6G rat monoclonal, clone RB6-8C5 (Abcam), anti-α-SMA rabbit monoclonal, clone 1A4 (Abcam), and anti-Mac-2 mouse monoclonal, clone M3/38 (Cederlane Labs, Burlington, Canada). This was followed by incubation with secondary antibody Anti-Rabbit Ig, ImmPress Reagent Peroxidase (Vector Laboratories) (CD3 and α-SMA) or Anti-Rat (Mouse adsorbed) Ig, Immpress Reagent Peroxidase (Vector laboratories) (Ly6G and Mac-2) for 30 minutes. Samples were next stained with DAB Peroxidase Substrate Kit (Vector Laboratories) for 2 (Mac-2),10 (CD3 and α-SMA) or 13 (Ly6G) minutes before staining with Hematoxylin QS (Vector Laboratories). The samples were rinsed 10 minutes in running water, dehydrated in ethanol, cleared in xylene and mounted. For quantification CD3, Ly6G and Mac-2 positive cells located by the bile ducts in
Supplementary Table 1
Gene
Col3a1 GenBank Acc. NM_009930
PrimerBank ID 20380522a1
Forward primer (5' -> 3') CTGTAACATGGAAACTGGGGAAA Reverse primer (5' -> 3') CCATAGCTGAACTGAAAACCACC Provided by DNA Technology, Risskov, Denmark
Col1a1 GenBank Acc. NM_007742
PrimerBank ID 34328108a1
Forward primer (5' -> 3') GCTCCTCTTAGGGGCCACT Reverse primer (5' -> 3') CCACGTCTCACCATTGGGG
Provided by DNA Technology, Risskov, Denmark
Mmp2 GenBank Acc. NM_008610
PrimerBank ID 6678902a1
Forward primer (5' -> 3') CAAGTTCCCCGGCGATGTC Reverse primer (5' -> 3') TTCTGGTCAAGGTCACCTGTC
Provided by DNA Technology, Risskov, Denmark
Timp1 GenBank Acc. NM_001044384
PrimerBank ID not applicable
Forward primer (5' -> 3') CTGTGGGGTGTGCACAGTGT Reverse primer (5' -> 3') GGACCTGATCCGTCCACAAA
Provided by Sigma-Aldrich, St.Louis, MO, USA
Actb GenBank Acc. NM_007393
PrimerBank ID 6671509a1
Forward primer (5' -> 3') GGCTGTATTCCCCTCCATCG Reverse primer (5' -> 3') CCAGTTGGTAACAATGCCATGT
Provided by DNA Technology, Risskov, Denmark
Supplementary Table 1. Detailed information for primers used in quantitative real-time polymerase chain reaction (qPCR) experiments for quantification of liver fibrosis. Beta-actin (Actb) was used as
reference gene. Acc; accession; Col1a1, collagen 1a1; Col3a1, collagen 3a1; Mmp2, matrix metalloproteinase 2; Timp1, tissue inhibitor of
metalloproteinases 1.
Antibody Clone
number Provided by
anti-mouse CD16/32 93 BioLegend, San Diego, CA, USA
anti-mouse TCRb H57-597 BD Biosciences, Franklin Lakes, NJ, USA anti-CD3 rabbit monoclonal SP7 Abcam, Cambridge, UK
anti-Ly6G rat monoclonal RB6-8C5 Abcam, Cambridge, UK anti-a-SMA rabbit monoclonal 1A4 Abcam, Cambridge, UK
anti-Mac-2 mouse monoclonal M3/38 Cederlane Labs, Burlington, Canada
Supplementary Table 2. Detailed information on antibodies used in flow cytometry and immunohistochemical experiments.
Mean blood glucose values NOD mice (mmol/L)
Before rederivation 6.92 (±0.68)
After rederivation 8.38 (±1.38)
Supplementary Table 3. NOD control mice were not diabetic. Non-fasting blood glucose measured in 10 weeks old NOD mice before harvesting of cecal mucosa and content. Values are presented as means ± SEM.
Supplementary Table 4. Bacterial taxa differ between NOD.c3c4 and control mice in cecal mucosa. In the first experiment, several taxa on the genus level were different between NOD.c3c4 and control mice in cecal mucosa (p <0.05). To examine differences in a new environment and rule out potential cage effects, we rederived the mice into another conventional animal facility. After rederivation there were still several taxa on the genus level that were different between NOD.c3c4 and control mice (p <0.05). Relative
abundance ratios were calculated by dividing the mean relative abundance of each bacterial taxon in each category. Cells shaded in grey denote taxa significantly enriched on NOD.c3c4 mice. Significant values (p <0.05) in bold.
#Mean relative abundance of the NOD-group = 0 in this calculation.
Taxa enriched in NOD.c3c4 mice Before rederivation
After rederivation into another conventional
animal facility
Order Family Genus
Relative abundance ratio
NOD.c3c4/NOD p-value
Relative abundance ratio
NOD.c3c4/NOD p-value Verrucomicrobiales Verrucomicrobiaceae Akkermansia -# 0.0075 2.44 0.383
Bacteroidales Bacteroidaceae Bacteroides 3.41 0.0079 1.47 0.190
Clostridiales Lachnospiraceae Coprococcus 0.20 0.0079 0.57 0.413
Clostridiales Ruminococcaceae Ruminococcus 2.77 0.0079 0.98 0.730 Erysipelotrichales Erysipelotrichaceae Allobaculum 0.002 0.0079 0.24 0.306 Clostridiales Lachnospiraceae Anaerostipes 0.002 0.0097 0.19 0.081 Deferribacterales Deferribacteraceae Mucispirillum 7.97 0.012 0.90 0.556 Erysipelotrichales Erysipelotrichaceae Coprobacillus 0.08 0.012 1.16 0.730 Anaeroplasmatales Anaeroplasmataceae Anaeroplasma 3.49 0.016 1.65 0.712
Clostridiales Mogibacteriaceae [unknown] 0.24 0.032 1.05 1.000
Burkholderiales Comamonadaceae Variovorax 0.27 0.032 0.80 0.556
Bacteroidales Prevotellaceae [unknown] 2.89 0.036 1.13 0.556
Lactobacillales Lactobacillaceae Lactobacillus 0.97 0.841 0.34 0.016
Clostridiales Clostridiaceae Clostridium 1.34 0.906 23.52 0.016
Clostridiales Lachnospiraceae Blautia 1.01 1.000 7.94 0.032
Rhodocyclales Rhodocyclaceae [unknown] 0.51 0.530 4.04 0.048
Supplementary Fig. 1
Supplementary Fig. 1. Histological scoring. H&E and Sirius red stained
sections were scored in a blinded fashion on the following parameters: portal inflammation (0-3), dilatations of intrahepatic bile ducts (0-3), fibrosis (0-3) and bile infarcts (0-2), where 0 was no pathology. Examples of portal
inflammation, fibrosis and bile infarcts are here captured in 40X magnification;
dilatations of intrahepatic ducts are captured in 10X magnification.
Portal inflammation Dilatation of intra-hepatic bile ducts
Bile infarcts Fibrosis
Score 0 Score 1 Score 2 Score 3
Supplementary Fig. 2. Germ free (GF) NOD.c3c4 mice have lower liver weight than conventionally raised (CONV-R) NOD.c3c4 mice. (A) Liver weights of CONV-R (n = 9-11) and GF NOD.c3c4 (n = 9-11) mice at 9 and 18 weeks (w) of age. (B) Liver weights of CONV-R (n = 5-6) and GF NOD (n = 4- 9) mice at 9 and 18 weeks (w) of age. Data are presented as mean ± SEM, unpaired Student's t-test used for comparison. ***p <0.001.
0 1 2 3
0 1 2 3
0 1 2
3
***
0 1 2
3
***
9 w
Liver weight (grams)
CONV-R GF
18 w
CONV-R GF
Liver weight NOD.c3c4
A
9 w
Liver weight (grams)
CONV-R GF
18 w
CONV-R GF
Liver weight NOD
B
Supplementary Fig. 3. The percentages of TCR beta positive cells are similar in NOD and NOD.c3c4 mice. (A) and (B) TCRb+ cells in perfused livers of NOD and NOD.c3c4 mice (n = 3-5 in each group). Data are presented as mean ± SEM.
30 40 50 60 70 80
% TCRβ+cells of lymphocytes
NOD NOD.c3c4 T cells in liver
TCR β+
% of maximum
NOD NOD.c3c4
A B
Supplementary Fig. 4. Germ free (GF) NOD.c3c4 mice have less
neutrophils around their bile ducts compared to conventionally raised (CONV-R) NOD.c3c4 mice at 9 weeks of age. GF NOD.c3c4 mice also have a tendency to reduced inflammatory portal infiltrates and bile infarcts
compared to CONV-R NOD.c3c4 mice at 9 weeks of age. (A) H&E (40X), Sirius red stained (40X) and Ly6G stained sections (40X) illustrating portal inflammation, bile infarcts, fibrosis and Ly6G positive cells (neutrophil marker, indicated by arrows). (B) Liver pathology in GF (n = 9) and CONV-R (n = 9) NOD.c3c4 mice scored on parameters portal inflammation, bile infarcts, fibrosis, dilatation of intrahepatic bile ducts (IHBD). Mean Ly6G positive cell count from 6 different areas with bile ducts. Data are presented as mean ± SEM, unpaired Student's t-test used for comparison. ***p <0.001.
Supplementary Fig. 5. Differences in liver biochemistry, spleen and cecum weight between germ free (GF) and conventionally raised (CONV- R) NOD.c3c4 mice. GF NOD.c3c4 mice have a tendency to reduced alanine transaminase (ALT) levels, higher aspartate transaminase (AST) and alkaline phosphatase serum levels (ALP), lower spleen weight and higher cecum weight than CONV-R NOD.c3c4 mice. (A) ALT, (B) AST and (C) ALP levels measured in serum of GF and CONV-R NOD.c3c4 at 9 (n = 9 in each group) and 18 weeks (w) of age (n = 11 in each group). (D) Spleen and cecum weights of CONV-R (n = 11) and GF NOD.c3c4 mice (n = 11) at 18 w of age.
Data are presented as mean ± SEM, unpaired Student's t-test used for comparison. *p <0.05, ***p <0.001.
0 50 100
150 ***
0 50 100 150
200 *
0 50 100 150 200
250 *
9 w
AST U/L
CONV-R GF
18 w
CONV-R GF Aspartate transaminase
B
Alkaline phosphatase
0 50 100
150 *
9 w
ALP U/L
CONV-R GF
18 w
CONV-R GF
C
0.00 0.05 0.10 0.15
0.20 ***
0 1 2
3 ***
18 w 18 w
Spleen weight NOD.c3c4
CONV-R GF
Spleen weight (grams)
CONV-R GF
D
Cecum weight (grams)
Cecum weight NOD.c3c4 0
20 40 60
80 P=0.14
0 20 40
60 P=0.11 9 w
ALT U/L
CONV-R GF
18 w
CONV-R GF
Alanine transaminase
A
