MASTER’S THESIS
ROLE OF MITOCHONDRIAL FUNCTION OF LUNG MESENCHYMAL STEM CELLS IN IDIOPATHIC PULMONARY FIBROSIS
Joan Truyols Vives
Master’s Degree in Biomedicine
(Specialisation/Pathway: Transversal) Centre for Postgraduate Studies
Academic Year 2019-20
ROLE OF MITOCHONDRIAL FUNCTION OF LUNG MESENCHYMAL STEM CELLS IN IDIOPATHIC
PULMONARY FIBROSIS
Joan Truyols Vives
Master’s Thesis
Centre for Postgraduate Studies University of the Balearic Islands
Academic Year 2019-20
Key words:
IPF, TGF-β, mitochondrial dysfunction, wound healing, mitochondrial biogenesis, mitophagy, mitochondrial membrane potential.
Thesis Supervisor’s Name: Dr. Josep Mercader Barceló
Index
Abstract ... 3
Introduction ... 4
Material and methods ... 6
Cells and culture systems ... 6
Reverse transcription PCR (RT-PCR) ... 6
Mitochondrial DNA isolation and quantification ... 7
Measurement of mitochondrial membrane potential (MMP) ... 8
Wound healing assay ... 9
Statistics ... 10
Results ... 10
1. Mitochondria-related gene expression in IPF lung MSC ... 10
2. Mitochondria content in IPF lung MSC ... 11
3. Mitochondria integrity in IPF lung MSC ... 11
4. TGF-b induces depolarization of mitochondria membrane in IPF MSC cells ... 12
5. Ability of IPF lung MSC to repair a scratch ... 13
6. IPF and non-IPF lung MSC present differences in the repair ability in response to starvation media ... 14
7. TGF-β treatment enhances the repair ability of IPF MSC on A549 cells more potently than non-IPF MSC. ... 16
8. TGF-β treatment differentially affects the expression of genes related to proliferation, migration and mitochondrial function in IPF vs non-IPF MSC ... 17
Discussion ... 18
Conclusion ... 19
Acknowledgments ... 20
Bibliography ... 20
Supplementary data ... 22
Figure 1S ... 22
Figure 2S ... 22
Abstract
Introduction: Idiopathic pulmonary fibrosis (IPF) is an age-related disease which consists in several damage in the lung due to an abundant scarring, deposition of extracellular matrix proteins and inflammation. Mesenchymal stem cells (MSC) play a role in tissue repair, however the involvement of resident MSC in IPF aetiology remains to be elucidated. Preliminary microarray analysis revealed that the most altered pathway in IPF MSC is oxidative phosphorylation. The aim of this study is to analyse mitochondrial function-related features and the repair activity of IPF lung MSC.
Material and methods: Human lung MSC from non-IPF and IPF patients will be used in cell culture assays. RT-PCR was used to study COX4, ATP6, PGC1-α and PINK1 expression levels, and ddPCR to estimate mitochondrial number. Mitochondrial membrane potential assay was set-up in the present work to evaluate mitochondrial integrity in lung MSC. Scratch assays was performed to analyse the ability of lung MSCs to repair damage in both direct and indirect co- culture with epithelial A549 cells.
Results: Compared to non-IPF cells, IPF MSC presented lower COX4 and PINK1 expression, similar mitochondrial membrane potential in the presence of TGF-β, and a delayed repair activity in both direct and indirect coculture systems, which was only evidenced in serum- restricted conditions. TGF-β incubation stimulated the repair activity of both IPF and non-IPF MSC, but the increase was more pronounced in IPF cells. TGF-β-incubated IPF MSC presented lower COX4, ATP6 and PINK1 expression, and TGF-β treatment induced the expression of the migration marker VEGF.
Conclusion: The impaired repair activity of IPF MSC is associated with signs of mitochondrial dysfunction, and this activity is more sensitive to TGF-β. TGF-β, in turn, induces mitochondrial dysfunction in IPF MSC. Collectively, these results suggest that the overproduction of TGF-β in the fibrotic lung may impair the repair activity of resident MSC by inducing mitochondrial dysfunction, which deserves further investigation.
Introduction
Idiopathic pulmonary fibrosis (IPF) consists in several damage in the lung due to an abundant scarring, deposition of extracellular matrix proteins and inflammation, being strongly associated with the typical pattern of interstitial pneumonia and normally affects middle-aged and older people. The excessive fibrosis and inflammation are responsible for respiratory failure and explain the high mortality, which is 3-5 years after diagnostic 1–5. The recent introduction of the anti-fibrotic agents pirfenidone and nintenadib in the clinical practice has increased the life expectancy of the IPF patients to eight years.
Despite the fact that the causes of IPF remain unknown, some evidence suggest that both host and environmental factors are involved in the initiation of the disease. In one hand, some studies associate development of pulmonary fibrosis to host factors which are strongly related to aging process, such as the alteration in genes responsible for the unfolded protein response, telomere shortening, senescence and mitochondrial dysfunction 6–10. Other relevant altered element associated to IPF pathogenesis is a polymorphism in the MUC5B promoter, which is linked to mucus hypersecretion which causes chronic inflammation and damage in bronchoalveolar region 11. In the other hand, environmental factors are also thought to play a role in IPF development. Such factors include cigarette smoke (CS), gastric aspiration, microorganism infection, and more recently, dietary factors have been posed as a potential key players in IPF 12–15.
IPF pathogenesis initiates with an injury in the epithelial lung cells. This stimulus provokes epithelium activation that evolves fibroblast and myofibroblast to close the injury.
Transforming growth factor-β (TGF-β) is overexpressed and mediates the epithelial to mesenchymal transition (EMT) (Figure 1). Thus, activated epithelial cells acquire mesenchymal phenotype becoming fibroblasts, which produce excessive collagen and extracellular matrix (ECM). This aberrant behaviour leads to an abnormal lung structure and dysfunction 1,11,16.
The involvement of mesenchymal stem cells (MSC) in IPF pathogenesis remains to be elucidated. Functional resident and extrapulmonary stem cells are needed to repair and regenerate in the context of daily attrition and injuries in lung tissue 17. Accordingly, studies in animal models of pulmonary fibrosis have demonstrated the repair activity of MSC. 18–22.
MSC may play an active role in the development of IPF. Cárdenes et al., 2018 study demonstrated that bone marrow-derived MSC presented altered mitochondrial activity and
DNA damage. Furthermore, since the inflammatory microenvironment alters MSC behaviour in several lung diseases, which can leads to an increase in pro-fibrotic compounds such as TGF-b and pro-inflammatory elements 24,25, it has also been suggested that MSC may also contribute to the development of pulmonary fibrosis 26,27.
Mitochondria dysfunction in alveolar epithelial cells and fibroblasts in IPF could also occur in lung MSC. Preliminary data from our research group on the gene expression profile using microarray analysis approach revealed that oxidative phosphorylation is the most altered pathway in lung MSC from IPF patients, which exhibited a significant down-regulation compared to lung MSC from non-IPF individuals. Furthermore, functional analysis showed that IPF lung MSC, under basal conditions, present a similar ability to proliferate and migrate, and an impaired repair activity compared to non-IPF lung MSC. However, upon TGF-β stimulation, IPF MSC showed a lower proliferation capacity and a higher migration capacity than non-IPF MSC, suggesting that IPF MSC are more sensitive to the profibrotic stimulus.
The aims of the present study are: (1) to validate the results obtained in the microarray analysis, and further, analyse mitochondrial function in IPF lung MSC, (2) to analyse the repair ability of lung MSC on damaged epithelial cells under TGF-β stimulation, and (3) to study potential molecular mechanisms that could explain the TGF-β-induced changes on proliferation, migration and mitochondrial function in IPF MSC.
Figure 1. Epithelial-to-mesenchymal transition (EMT) mechanisms provoking the recruitment of fibroblasts during the development of idiopathic pulmonary fibrosis. Epithelial cells turn into fibroblasts due to the action of some stimuli like wound clotting or TGF-b (King et al, 2011). TGF-b: transforming growth factor;
PDGF: platelet-derived growth factor; CXCL12: chemokine ligand; CXCR4:
chemokine receptor.
Material and methods
Cells and culture systems
Primary lung mesenchymal stem cells (MSC) from human samples isolated from deceased IPF patients and non-IPF donors and human lung adenocarcinoma cell line A549 (ATCC®CCL-185TM) were used in the present work. Lung MSC were previously characterized for their mesenchymality according the Rohart test 28.
MEM Alpha free serum (Biowest, L0475-500) and RPMI or DMEM-F12 medium (Biowest, L0091) were used as culture medium for MSC and A549 cells, respectively, and both were supplemented with 10% Fetal Bovine Serum (FBS, Biowest, S1810-050) and 1%
penicillin/streptomycin antibiotics (Biowest, L0018-100). When indicated, both cells were treated with TGF-b (casa commercial). Both cell types were seeded in plastic flasks in their corresponding media and incubated in chambers at 37ºC and with 5% CO2. When cells reached confluence, they were washed with phosphate buffered saline (PBS, Biowest, L0615-500), detached with Trypsin-EDTA 1X (Biowest, L0930-100) and plated in new flasks with fresh medium. MSC were grown in standard conditions (10% FBS) or in starvation media (2% FBS) depending on the purpose of the experiment.
Reverse transcription PCR (RT-PCR)
mRNA expression levels of selected genes were measured by RT-PCR. The selected genes were COX4 (Cytochrome c oxidase subunit 4), ATP6 (ATP synthase 6), PGC1-α (Peroxisome proliferator-activated receptor gamma coactivator 1-alpha), PINK1 (PTEN-Induced Kinase 1), CCND1 (Cyclin D1) and VEGF (Vascular Endothelial Growth Factor).
RNA was extracted following EXTRACTME® protocol (Blirt, EM09.1-250). Briefly, 600 µl TRItidy G (AppliChem A4051,0100) were added to each well and were scraped to remove cells from the bottom. Cells were transferred into an RNase free Eppendorf, 150 µl chloroform were added and samples were mixed. After centrifugation, the aqueous upper phase was collected, mixed with 500 µl isopropanol and the solution was transferred to an RNA Purification Column. Columns were washed (with RW1 and RW2 Buffer) and RNA was eluted with 30 μlof elution buffer REB. Samples were analysed with nanodrop to obtain RNA concentration and the quality extraction. RNA samples were stored at -80ºC.
Next step consisted in mixing 2 µl 10x RT reaction buffer, 1µl RIOprotect RNAse inhibitor, 1 µl reverse transcriptase, 1 µl random nonamers, 1 µl 10 mM dNTP mix, 4µl RNAse free water and 10 µl of the template RNA (previously denatured 5 min at 60ºC), to synthetize cDNA (Transcriptme RNA kit cDNA synthesis kit, Blirt, RT31-100) by incubating the mixture 10 minutes at 25ºC for primer annealing, 30 minutes at 50ºC for reverse transcription, 5 minutes at 85ºC to inactivate the enzyme and at last hold to 4ºC.
The cDNA was amplified by a 2-step real-time PCR (qPCR) using the kit NoROX SensiFAST SYBR (Bioline, 98005) and gene expression levels were normalized by using b2-m (encoding for microglobulin b2) RNA as a housekeeping gene. Premixed primers were used for ATP6, COX4, PINK1, PGC1-α, Cyclin D1(CCD1) and VEGF to a final 500nM concentration (Table 1).
Mitochondrial DNA isolation and quantification
Mitochondrial DNA levels were measured by droplet digital PCR (ddPCR). MSC were seeded in basal conditions (medium supplemented with 10% FBS) in a 24 well-plate at a concentration of 50.000 cells per well. DNA was extracted with Dneasy Blood & Tissue Kit following kit instructions (Qiagen, cat. Nº69504). Briefly, cells were detached and lysed using Proteinase K and Lysis Buffer and transferred into an Rnase free Eppendorf. Cells were incubated at 56ºC for 10 min and mixed with ethanol 96%. Then, they were transferred to a Dneasy Mini spin column and were washed with kit buffers (AW1 & AW2). Finally, DNA was eluted with Buffer AE and diluted to 1,2 ng/µl.
Next step was to prepare ddPCR master mix which consists in 10µl ddPCRTM supermixes for Probes (no dUTP) from BioRad (Cat. 1863023) with 5 µM probe carrying FAM and 5 µM probe carrying HEX; and 18 µM primer and 18 µM forward primers. 5 µl were added to this mix and the generation of drops with Droplet generation oil for Probes (BioRad, 64351408) was
Table 1. Primers used in qPCR.
carried out. The drops were transferred to a 96-well plate which was put into thermocycler where DNA was amplified. Finally, amplification fluorescence products from mitochondrial and nuclear DNA were read with QX200 Droplet Reader and data were analysed with QuantaSoft Analysis. Atp6 (Forward: 5’ ACAACTAACCTCCTCGGACT3’ Reverse: 5’
TGCCTTGTGGTAAGAAGTAGTGG 3’) and Rpp30 (Forward: 5’ GATTTGGACCTGCGAGCG and Reverse: 5’ GCGGCTGTCTCCACAAGT) were amplified to quantify mitochondrial and nuclear DNA, respectively.
Measurement of mitochondrial membrane potential (MMP)
Mitochondrial membrane potential was measured using tetramethyl-rodamine methyl ester (TMRM, Molecular Probes, T668). This cationic dye easily accumulates into active mitochondria due to their relative negative charge. Depolarized or inactive mitochondria present a diminished membrane potential and they accumulate less TMRM.
A549 cells and MSC isolated from umbilical cord and lung tissue were used in TMRM assays at passages between 12-15 in umbilical cord MSC and 8-10 in lung MSC. Carbonyl cyanide 3- chlorophenylhydrazone (CCCP,Sigma-Aldrich, C2759) was used as a negative control, as it induces depolarization and eliminates the potential of the mitochondrial membrane, reducing the TMRM staining.
Cells were seeded in a black 96-well plate with clear bottom (SPL, 33396). Next day, media were removed, and cells were washed once with PBS. Negative control wells were incubated with medium containing CCCP and the other wells were incubated with the corresponding media. Plates were incubated for 10 minutes at 37ºC and then TMRM was added in the corresponding wells. In each assay, wells without TMRM nor CCCP were included as blanks.
CCCP and TMRM concentrations used in each assay are described in the Results section. After 30 minutes with TMRM incubation, cells were washed with PBS. Fluorescence was measured with Synergy H1 plate reader. TMRM has an excitation peak at 548 nm and the emission one is at 574 nm.
Fluorescence was normalized by cell number by staining the cells with DRAQ5 (ThermoFisher, 65-0880-92), DAPI (Sigma-Aldrich, D9542) or HOESCHT (Sigma-Aldrich, B1155) at 20µM, 5µg/ml and 5µg/ml, respectively.
Wound healing assay
The cell capacity to repair damage was assessed by a scratch assay. To reproduce a profibrotic environment, cells were pre-treated with 10ng/ml TGF-b for 48 hours. Two experimental designs using co-cultures should be distinguished:
A. Direct co-culture: A549 cells and MSC were stained using Jade CellVue (green) and Maroon CellVue (red) stainings, respectively. In direct co-culture with no TGF-b stimulation cells were seeded in 24-well plate as explained below. In the TGF-b assay, MSCs were seeded in 6-well plates at 200.000 cells/well. Next day, they were put on starvation media for 6 hours. Then, cells were treated with 10 ng/ml TGF-b or 0,1% bovine serum albumin in PBS (vehicle) in starvation media. Cells were incubated 48 hours before going into co-culture.
In parallel, A549 cells were cultured in 175cm2 flasks with RPMI medium supplemented with 10% FBS and 1% antibiotics.
After TGF-b incubation, MSC were seeded together with A549 cells in triplicates in a 24- well plate at 1:1 ratio at a final concentration of 200.000 total cells/well in starvation media. 200.000 A549 cells/well were seeded in the control group.
Next day, a scratch was performed in each well with a pipette tip to generate a free cell area. Each well was washed with PBS and incubated with exo-depleted media (MEM Alpha plus 2% exo-free FBS (Biowest, S181M-100) and 1% penicillin/streptomycin). The scratch areas were photographed by the ZEISS D1 Inverted Cell Observer microscopy in a 200 µm scale. Pictures of the same area were recorded after 12, 24, 36 and 48 hours to quantify cell repair. Image J program was used to determine free cell area. Each area was referred to their corresponding 0h time-point. From these values, wound closure was calculated as percentage value.
B. Indirect or insert co-culture: MSC were seeded in triplicates in inserts (6,5 mm Transwell®
with 0,4 µm Pore Polyester Membrane Insert, Sterile, catalogue nr. #3470) at 20.000 cells per insert by placing a 150 µl drop on the outer part of a bottom-up insert. Once the cells were attached, inserts were turned to normal position and placed into 24-well plate, and both the inserts and the wells were filled with 100 µl and 500 µl starvation media, respectively.
After 6h of starvation, cells were treated with 10 ng/ml TGF-b or 0,1% BSA PBS (vehicle) in starvation media for 48 h. In parallel, A549 cells were seeded in triplicates in standard
media. in 24-well plates at a density of 200.000 cells/well. Once A549 cells were attached and completely covered the bottom of the well, the scratch was performed, each well was washed with PBS and incubated with exo-depleted media. The scratches were photographed and analysed as described before. After taking the pictures, A549 cells were incubated with the inserts containing the MSC.
Statistics
Graphical representations and statistical analyses were performed using GraphPad Prism 8.
Data were represented as mean ± SEM. Significant differences were determined by two-way ANOVA followed by Bonferroni multiple comparisons test and by a Student t-test. Differences were considered significant at P< 0.05 (*).
Results
1. Mitochondria-related gene expression in IPF lung MSC
mRNA expression levels in IPF and non-IPF MSC cultured under basal conditions (with 10% FBS) were measured to validate the preliminary microarray analysis results previously performed by our research group. Selected genes for this validation were COX4 and ATP6, involved in mitochondrial electron chain transporter and oxidative phosphorylation, which were downregulated in the IPF group in the microarray analysis. Moreover, we were interested in measuring the mRNA expression of other mitochondria-related genes, such as PGC1-α, a cofactor that controls mitochondrial biogenesis; and PINK1, a mitochondrial kinase that regulates stress-induced mitophagy. Under basal conditions, COX4 mRNA levels showed a decreasing trend in IPF cells compared to non-IPF cells (P=0.063), while no statistical differences were found in the expression of the other genes (Figure 2A).
Next approach was to evaluate differences in the mRNA levels of these genes between IPF and non-IPF MSC in deprivation conditions (2% FBS), as such culture conditions were used in the functional assays in which the effect of TGF-b was analysed. Results presented in Figure 2 show lower COX4 and PINK1 mRNA levels in IPF compared to non-IPF cells. However, ATP6 and PGC1-α presented no differences in gene expression between these two groups.
2. Mitochondria content in IPF lung MSC
Mitochondrial DNA content was measured by ddPCR as an indicator of mitochondria number to assure whether the lower expression of oxidative phosphorylation-related genes in IPF cells could be attributed to a diminished mitochondria content. However, these results showed that IPF and non-IPF MSC presented similar DNA content (Figure 3).
3. Mitochondria integrity in IPF lung MSC
Mitochondria integrity was analysed by assessing changes in mitochondrial membrane potential in non-IPF and IPF lung MSC. Due to the limited human lung tissue samples, the experiments designed to set up the methodology were carried out in A549 cells and human
Figure 2. mRNA expression levels of COX4, ATP6, PGC1-α and PINK1 in basal conditions (10% FBS) (A) or starvation media (2% FBS) for three days. Plots represent mean ± SEM. n= 6,7 per group in (A) and n=3 per group in (B). Student t-test was used for statistical analysis *P<0.05, ***P<0.001.
Non-IPF L-MSC IPF L-MSC 0
100 200 300 400 500
Ratio DNAmt/DNAnuc
Non-IPF L-MSC IPF L-MSC
Figure 3. Mitochondrial and nuclear DNA ratio in IPF and non-IPF cells. Plots represent mean ± SEM. n= 7 per non-IPF group and n=8 per IPF group. Student t-test was used for statistical analysis, using a two-tailed test.
umbilical cord MSC (UC-MSC). TMRM assays in A549 allowed us to analyse changes in TMRM fluorescence according the seeded cell number, TMRM and CCCP concentrations, and TMRM/CCCP ratio. TMRM assays in A549 cells at a 40.000 cells/well density showed that the preincubation with 10μM CCCP for 10 min followed by the addition of 200 nM TMRM for 30min resulted in the highest TMRM/CCCP ratio (Fig S1, Supplementary data). However, preliminary assays in lung MSC showed that a higher TMRM concentration was required to obtain a substantial fluorescence signal in these cells and, in addition, we noted that lung MSC were more sensitive to CCCP preincubation, as well as to the washing steps than A549 cells.
Therefore, we preincubated lung MSC with 5 μM CCCP, a dose that did not triggered significant cell death at the selected incubation time and were subsequently incubated with 300 nM TMRM for 30 min. Lastly, TMRM fluorescence signal was normalized by 20 µM DRAQ5 staining.
Upon the mentioned experimental conditions, IPF lung MSC showed a similar mitochondrial membrane potential than non-IPF lung MSC (Figure 3).
4. TGF-b induces depolarization of mitochondria membrane in IPF MSC cells
To study the potential effect of TGF-b on MSC mitochondrial membrane potential, we first used UC-MSC to analyse TGF-b dose and incubation time responses. Time-response curve showed that the incubation with 10 ng/ml TGF-b did not triggered changes in TMRM fluorescence after 12-hour incubation (Fig S2A), but after both 24 and 36 hours, TMRM fluorescence was significantly increased by 45% and 132%, respectively. Prolonged treatment to 48h returned TMRM fluorescence to basal levels. Thus, 24-hour incubation time was selected to analyse TGF-b dose response. After the incubation with 1, 5 and 10 ng/ml TGF-b, TMRM fluorescence was 23, 25 and 24% higher when compared to vehicle group, which was set at 100% (Fig S2B), but such differences did not reach statistical significance.
Non-IPF L-MSC IPF L-MSC 0
500 1000 1500 2000
TMRM fluorescence intensity normalized by cell number
Non-IPF L-MSC IPF L-MSC
Figure 4. TMRM fluorescence signal in non- IPF and IPF cells under incubation with 300nM TMRM. TMRM fluorescence was normalized by 20µM DRAQ5. Plots represent mean ± SEM. N=3 per group, triplicates per N. Student t-test was used for statistical analysis, using a two-tailed test.
Finally, we aimed at assessing whether a profibrotic agent could induce changes in mitochondria integrity of lung MSC, and then, to analyse potential differences in the response to TGF-b between IPF and non-IPF cells. To figure it out, cells were incubated with 10ng/ml TGF-b or vehicle for 24h.There were no differences in TMRM fluorescence between IPF and non-IPF cells treated with vehicle (Figure 4), in accordance with the results showed previously in Figure 3. Interestingly, TGF-b treatment significantly reduced TMRM fluorescence in IPF lung MSC. On the contrary, in non-IPF MSC, TGF-b treatment did not trigger changes in TMRM fluorescence, suggesting that TGF-b may impair mitochondria integrity only in lung MSC from IPF patients.
5. Ability of IPF lung MSC to repair a scratch
The repair ability of IPF lung MSC was first evaluated by measuring the wound closure after applying a scratch in MSC that were co-cultured 1:1 with A549 cells in basal media. As represented in Figure 5, the initial wound area, did not present any statistical differences between the three experimental groups. Wound closure in A549 control group was significantly different from time 0h after 36h (P<0.01), while when A549 cells were cocultured with lung MSC, from either IPF or non-IPF, wound closure was produced faster since at 12 h the difference vs 0h was already significant (P-<0.01 in each group). However, there were no changes in wound reparation between non-IPF and IPF groups in basal conditions, unlike preliminary data from our group that showed an impaired ability to repair the scratch in IPF vs non-IPF lung MSC, a result that may reflect the heterogeneity of IPF.
Vehicle TGF-β
0 20 40 60 80 100
Fluorescence intensity normalized by cell number (x100)
Non-IPF L-MSC IPF L-MSC
#
Figure 5. Mitochondrial membrane potential in lung mesenchymal stem cells from non-IPF and IPF patients in the presence of TGF-β. Assay was performed with 300nM TMRM in the presence of 10ng/ml TGF-β for 24h or vehicle.
Error bars indicate SEM. n=2 per group. Significant differences were obtained by 2way ANOVA with multiple comparison, Bonferroni post-test #P<0.05. # represents statistical differences between vehicle and TGF-β condition.
6. IPF and non-IPF lung MSC present differences in the repair ability in response to starvation media
In the second wound healing assay we intended to analyse the repair ability of lung MSC simulating the fibrotic conditions of the IPF lung. Here, cells were incubated in starvation media with or without 10 ng/ml TGF-b before cell scratching. As it is shown in Figure 6, there were no statistical differences in wound area at time-point 0h. We first analysed the results obtained in cells treated with vehicle in order to assess whether culture conditions could differentially affect the repair activity. Thus, under starvation media, wound closure of A549 cells was different from time-point 0h only at 48h (P<0.01). Unlike A549 control group wound closure in the non-IPF group was already increased at 12h (P<0.05) and thereafter. In the IPF group, interestingly, we observed a delay compared to non-IPF group, since wound closure was not increased until 24h (P-<0.001) compared with 0h time-point. When differences between non-IPF and IPF groups vs A549 group were analysed, we observed a higher wound closure in non-IPF vs A549 control group at 48 h (P<0.01), but not in the IPF group. Moreover,
Figure 6. Scratch assay of lung MSC in coculture with A549 cells. A represents images of wound closure at time 0h, 12h, 24h, 36h and 48h in the different groups in bright field and B) in fluorescence (red and green fluorescence represents mesenchymal stem cells and A549 cells respectively). C represents the graphics corresponding to the percentage of closure area over time. Error bars indicate SEM. n=3 per group, triplicates per n and quadruplicate per A549 group. Significant differences were obtained by 2way ANOVA, Bonferroni post-test, ℶ P<0.05, ℶℶ P<0.01, ℶℶℶ P<0.001. ℶ represents differences in timepoints compared with time 0h.
IPF MSC presented a lower wound closure than non-IPF cells at 48h (P<0.05), which suggested that IPF lung MSC present an impaired repair ability when cultured in starvation media.
Upon TGF-b pre-stimulation, despite we did not find significant differences between TGF-b and vehicle in neither IPF nor non-IPF groups, wound closure in the IPF group was enhanced by TGF-b incubation after 12h(P<0.01), while no increase was observed in the vehicle condition in this group, suggesting that TGF-b may exert a more potent effect on the repair activity in IPF cells.
Figure 7. Scratch assay of A549 cells in direct co-culture with IPF and non-IPF cells after 48h incubation with 10ng/ml TGF-β. A represents images of wound closure at time 0h, 12h, 24h, 36h and 48h in the different groups in bright field and B) in fluorescence (red and green fluorescence represents mesenchymal stem cells and A549 cells respectively). C represents the graphics corresponding to the percentage of closure area over time in the different groups. Error bars indicate SEM. n=3 per group, triplicates per n. Significant differences were obtained by 2way ANOVA, Bonferroni post- test, *P<0.05, ** P<0.01,***P<0.001. ℶ represents differences in time-points compared with time 0h, # represents differences between IPF and non-IPF groups, and $ represents differences between IPF or non-IPF compared A549 control group.
7. TGF-β treatment enhances the repair ability of IPF MSC on A549 cells more potently than non-IPF MSC
Next, the repair ability of lung MSC was analysed in indirect co-culture in order to check whether MSC are able to induce repair on A549 epithelial cells through secreted factors. Non- IPF and IPF cells were seeded in inserts and were incubated in starvation media supplemented with or without 10 ng/ml TGF-b. At 0h time-point, all groups started with a no statistical difference in wound area (Figure 7). Referring to timeline, a significant increase in wound closure was seen in all groups from time-point 24h and forward. Despite there were no differences between untreated IPF and non-IPF groups vs A549 control group, non-IPF group showed a higher wound closure as early as 48h, while in IPF group such difference was not significant until 72 h, suggesting a delayed repair ability in IPF MSC also under indirect co- culture.
In non-IPF group, the repair activity was enhanced by TGF-b pre-treatment after 72 h (P<0.05), while in IPF group, TGF-b treatment enhanced the repair activity earlier, as at 24h time-point the difference was already significant (P<0.01) and remained higher at the following time points.
Figure 8. Scratch assay of A549 control group with inserts containing IPF or non-IPF cells after 48h incubation with 10ng/ml TGF-β. A represents images of wound healing closure during 72h in the different groups in bright field and B) represents the graphics corresponding to the percentage of closure area over time in the different groups. Error bars indicate SEM. N=3 per group, triplicates per N. Significant differences were obtained by 2way ANOVA, Bonferroni post- test, *P<0.05, ** P<0.01,***P<0.001. ℶ represents differences in timepoints compared with time 0h, # represents
8. TGF-β treatment differentially affects the expression of genes related to proliferation, migration and mitochondrial function in IPF vs non-IPF MSC
The mRNA expression levels of genes involved in oxidative phosphorylation, mitochondrial dynamics, cell proliferation and migration were studied in order to decipher the molecular mechanism that could help to explain the particular altered response of IPF lung MSC to TGF-b treatment that was previously reported in our proliferation and migration functional assays, and here, on the mitochondrial membrane potential and the repair ability. The selected genes were COX4, ATP6, PGC1-α and PINK1 (Figure 8A) and their expression was analysed after the incubation with 10 ng/ml TGF-b for 48 h. COX-4, PINK1 and PGC1-α mRNA levels were not changed after 48 h TGF-b incubation in IPF or non-IPF MSC, while ATP6 presented a trend to increase in the non-IPF group (P=0.073). Despite no significant changes were elicited by TGF-b treatment, significant lower mRNA levels of ATP6, COX4 and PINK1 were found in IPF MSC vs non-IPF MSC within TGF-b condition. A trend to decreased PGC1-α mRNA levels in IPF lung MSC was noticeable in both vehicle and TGF-b-treated groups but failed to reach statistical significance due to high variability in the expression levels of this gene.
The mRNA expression levels of Cyclin D1 and VEGF were analysed because are key genes involved in proliferation and migration, respectively. Their expression was determined after 48h (Cyclin D1) and 6h (VEGF) incubation with 10ng/ml TGF-β. As shown in figure 8B, TGF-β treatment did not trigger changes in Cyclin D1 mRNA levels. Finally, TGF-β treatment significantly induced the expression of VEGF in IPF MSC and only tended to increase in non-IPF MSC (P= 0.0502). No differences in the expression of Cyclin D1 and VEGF were found between IPF and non-IPF groups.
Figure 9. A) mRNA expression levels of COX4, ATP6, PGC1-α and PINK1 after the incubation without or with10ng/ml TGF-β for 48h. B) mRNA expression levels of Cyclin D1 and VEGF after the incubation without or with 10ng/ml TGF-β for 48h or 6h, respectively. Error bars indicate SEM. n=3,2 per group. Significant differences were obtained by 2way ANOVA with multiple comparison, Bonferroni post-test. *P<0.05, **P
Discussion
To sum up, in this study we demonstrated that IPF MSC presented signs of mitochondrial dysfunction evidenced by an impaired mitochondrial integrity and a lower capacity for oxidative phosphorylation and mitophagy, which were associated to an altered repair activity.
These features could be explained by a different TGF-β response.
The differences in the parameters analysed in this work between IPF vs non-IPF MSC were more evident in serum-restricted than in basal conditions. As an example, COX4 and PINK1 mRNA levels are lower in IPF MSC under serum-restricted medium, but such differences were not significant under basal conditions, in spite of the fact that a lower n was used in the restricted conditions (n=3 vs n=6-7). Starvation leads to mitochondrial biogenesis and under lower energy availability conditions we found a lower COX4 expression in IPF MSC. This result could be indicative of respiratory chain dysfunction and is in line with the impaired mitochondrial respiratory chain found in IPF lung biopsies, which is triggered by the formation of reactive species of oxygen (ROS), which in turn are known to activate TGF-β 29. Likewise, as seen by some studies, starvation leads to an oxidative stress which deteriorates mitochondrial function, and such stimulus increases the expression of genes that promotes mitophagy, such as PINK1 30,31. Accordingly, we could expect PINK1 activation under our restricted-serum conditions, and the lower PINK1 expression found in IPF MSC could indicate that these cells present an impaired capacity to activate mitophagy. All in all, our results in lung MSC gene expression are in connection with the reduced expression of the key genes involved in mitochondrial biogenesis and mitophagy, namely PGC1-α and PINK1, found in other pulmonary cells 29,32–34. In our hands, PGC1-α expression levels were not significantly different between IPF vs non-IPF because the expression of this gene was undetectable in some IPF samples, evidencing the decreased mitochondrial biogenesis potential in these patients and highlighting the heterogeneity of this disease.
The lower mitochondria-related gene expression found in IPF cells lead us to think whether mitochondrial number could be diminished in these cells. The similar mitochondrial/nuclear DNA ratio at the expenses of the lower mitochondria-related gene expression could reflect the fact that IPF cells accumulate dysfunctional mitochondria, probably due to deficiencies in the mitophagy and in oxidative phosphorylation efficiency 35. This rationale is further supported by our findings in IPF cells on the mitochondrial membrane potential showing a decreased mitochondrial integrity.
The decreased mitochondrial membrane potential in response to TGF-β reveals that a pro- fibrotic ambient induces the loss of mitochondria integrity in IPF MSC and demonstrates that these cells exhibit a higher susceptibility to fibrotic stimuli than in non-IPF cells. Our results agree with several studies on lung epithelial cells in which mitochondrial membrane potential was also diminished in response to TGF-β, and this effect was linked to increased ROS and decreased ATP levels 36,37.
Our mitochondrial dysfunction indicators could contribute to the delayed repair activity showed by IPF MSC in serum-restricted conditions observed in both direct and indirect culture since this cell activity requires energy. On the contrary, when cells are cultured in higher serum levels, differences in the repair activity between IPF vs non-IPF MSC are lost. Thus, abundant energy availability could mask the differences on repair activity, as well it also could explain the different results obtained in COX4 and PINK1 expression in high and low serum conditions.
In the presence of TGF-β, we observed different closure patterns between the two groups, where IPF cells showed an earlier response to TGF-β repairing the wound faster with TGF-β than without, in both direct and indirect co-culture. Altogether, IPF cells seem to be more sensitive to TGF-β probably because of the high TGF-β levels found in the fibrotic environment in IPF.
Furthermore, we demonstrate that the particular TGF-β response of IPF MSC is associated with lower levels of COX4, ATP6 and PINK1, which further suggests the connection between mitochondrial dysfunction and impaired MSC fitness in IPF. These results are in agreement with other studies in which it was demonstrated that TGF-β suppresses the expression of genes related to mitochondrial function and biogenesis and induced mitochondrial dysfunction in other pulmonary cells 37–39.
Conclusion
We demonstrate that MSC from IPF patients present an impaired repair activity that could be explained by signs of mitochondrial dysfunction. Moreover, the repair activity of IPF MSC seem to be more sensitive to TGF-β, and TGF-β, in turn, induces mitochondrial dysfunction in IPF MSC. Collectively, these results suggest that the overproduction of TGF-β in the fibrotic lung may impair the repair activity of resident MSC by inducing mitochondrial dysfunction, which deserves further investigation
Acknowledgments
This work has been carried out thanks to the contribution, first, of the main researcher of the group Ernest Sala. Secondly, I would like to thank the people who have helped me every day in the laboratory, such as Amanda Iglesias and Aina Martin. Next, I am grateful to Andreas Jahn and Carlos Rio for all the advice they have given me both on cell culture and laboratory management issues. Third, I want to thank especially my tutor, Josep Mercader, who welcomed me into the laboratory, has been helping me at all times and for his dedication in explaining the ins and outs of the work I have done.
Finally, I wanted to thank my family and friends who have been supporting me outside the laboratory all these months.
Bibliography
1. Barratt, S., Creamer, A., Hayton, C. & Chaudhuri, N. Idiopathic Pulmonary Fibrosis (IPF): An Overview. Journal of Clinical Medicine 7, 201 (2018).
2. Bueno, M., Calyeca, J., Rojas, M. & Mora, A. L. Mitochondria dysfunction and metabolic reprogramming as drivers of idiopathic pulmonary fibrosis. Redox Biology (2020)
doi:10.1016/j.redox.2020.101509.
3. Idiopathic Pulmonary Fibrosis | National Heart, Lung, and Blood Institute (NHLBI).
https://www.nhlbi.nih.gov/health-topics/idiopathic-pulmonary-fibrosis.
4. Torrisi, S. E. et al. Comorbidities of IPF: How do they impact on prognosis. Pulmonary Pharmacology & Therapeutics 53, 6–11 (2018).
5. Werderman, D. S. Idiopathic Pulmonary Fibrosis. RADIOLOGIC TECHNOLOGY 91, 19 (2020).
6. Lawson, W. E. et al. Endoplasmic reticulum stress enhances fibrotic remodeling in the lungs. Proceedings of the National Academy of Sciences 108, 10562–10567 (2011).
7. Naikawadi, R. P. et al. Telomere dysfunction in alveolar epithelial cells causes lung remodeling and fibrosis. JCI Insight 1, (2016).
8. Tsakiri, K. D. et al. Adult-onset pulmonary fibrosis caused by mutations in telomerase.
Proceedings of the National Academy of Sciences 104, 7552–7557 (2007).
9. Álvarez, D. et al. IPF lung fibroblasts have a senescent phenotype. Am J Physiol Lung Cell Mol Physiol 313, L1164–L1173 (2017).
10. Schuliga, M. et al. Mitochondrial dysfunction contributes to the senescent phenotype of IPF lung fibroblasts. J Cell Mol Med 22, 5847–5861 (2018).
11. Yang, I. V., Fingerlin, T. E., Evans, C. M., Schwarz, M. I. & Schwartz, D. A. TRANSATLANTIC AIRWAY CONFERENCE. 12, 7 (2015).
12. Jensen, K. et al. General mechanisms of nicotine-induced fibrogenesis. FASEB J 26, 4778–
4787 (2012).
13. Mercader-Barceló, J. et al. Insights into the Role of Bioactive Food Ingredients and the Microbiome in Idiopathic Pulmonary Fibrosis. Int J Mol Sci 21, (2020).
14. Spira, A. et al. Effects of cigarette smoke on the human airway epithelial cell transcriptome.
Proc Natl Acad Sci U S A 101, 10143–10148 (2004).
15. Zaman, T. & Lee, J. S. Risk factors for the development of idiopathic pulmonary fibrosis: A review. Curr Pulmonol Rep 7, 118–125 (2018).
16. King, T. E., Pardo, A. & Selman, M. Idiopathic pulmonary fibrosis. The Lancet 378, 1949–
1961 (2011).
17. Gomperts, B. N. & Strieter, R. M. Stem Cells and Chronic Lung Disease. Annual Review of Medicine 58, 285–298 (2007).
18. Felix, R. G. et al. Pulmonary fibrosis modulation by mesenchymal stem cells and conditioned medium. European Respiratory Journal 54, (2019).
19. Huleihel, L., Levine, M. & Rojas, M. The potential of cell-based therapy in lung diseases.
Expert Opin Biol Ther 13, 1429–1440 (2013).
20. Islam, M. N. et al. Mitochondrial transfer from bone-marrow-derived stromal cells to pulmonary alveoli protects against acute lung injury. Nat. Med. 18, 759–765 (2012).
21. Ortiz, L. A. et al. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci U S A 100, 8407–8411 (2003).
22. Srour, N. & Thébaud, B. Mesenchymal Stromal Cells in Animal Bleomycin Pulmonary Fibrosis Models: A Systematic Review: MSCs in Animal Bleomycin Pulmonary Fibrosis Models. STEM CELLS Translational Medicine 4, 1500–1510 (2015).
23. Cárdenes, N. et al. Senescence of bone marrow-derived mesenchymal stem cells from patients with idiopathic pulmonary fibrosis. Stem Cell Res Ther 9, 257 (2018).
24. Abreu, S. C. et al. Lung inflammatory environments differentially alter mesenchymal stromal cell behavior. Am J Physiol Lung Cell Mol Physiol 317, L823–L831 (2019).
25. Antoniou, K. M. et al. Investigation of bone marrow mesenchymal stem cells (BM MSCs) involvement in idiopathic pulmonary fibrosis (IPF). Respiratory Medicine 104, 1535–1542 (2010).
26. Marriott, S. et al. ABCG2pos lung mesenchymal stem cells are a novel pericyte
subpopulation that contributes to fibrotic remodeling. Am. J. Physiol., Cell Physiol. 307, C684-698 (2014).
27. Skurikhin, E. G. et al. Differentiation of Mesenchymal Multipotent Stromal Cells of the Lungs in Pneumofibrosis. Bulletin of Experimental Biology and Medicine; New York 154, 537–43 (2013).
28. Rohart, F. et al. A molecular classification of human mesenchymal stromal cells. PeerJ 4, e1845 (2016).
29. Jaeger, V. K. et al. Mitochondrial DNA mutations and respiratory chain dysfunction in idiopathic and connective tissue disease-related lung fibrosis. Sci Rep 9, 1–8 (2019).
30. Klinkenberg, M. et al. Restriction of trophic factors and nutrients induces PARKIN expression. Neurogenetics 13, 9–21 (2012).
31. Wang, S. et al. A novel cytoprotective peptide protects mesenchymal stem cells against mitochondrial dysfunction and apoptosis induced by starvation via Nrf2/Sirt3/FoxO3a pathway. J Transl Med 15, (2017).
32. Bueno, M. et al. PINK1 attenuates mtDNA release in alveolar epithelial cells and TLR9 mediated profibrotic responses. PLOS ONE 14, e0218003 (2019).
33. Caporarello, N. et al. PGC1α repression in IPF fibroblasts drives a pathologic metabolic, secretory and fibrogenic state. Thorax 74, 749–760 (2019).
34. Tsubouchi, K., Araya, J. & Kuwano, K. PINK1-PARK2-mediated mitophagy in COPD and IPF pathogeneses. Inflamm Regen 38, 18 (2018).
35. Zank, D. C., Bueno, M., Mora, A. L. & Rojas, M. Idiopathic Pulmonary Fibrosis: Aging, Mitochondrial Dysfunction, and Cellular Bioenergetics. Front Med (Lausanne) 5, (2018).
36. Sun, X. et al. TGF-β1 attenuates mitochondrial bioenergetics in pulmonary arterial endothelial cells via the disruption of carnitine homeostasis. Redox Biology 36, 101593 (2020).
37. Zhang, J. et al. TGF-β1 induces epithelial-to-mesenchymal transition via inhibiting mitochondrial functions in A549 cells. Free Radical Research 52, 1432–1444 (2018).
38. Grunwell, J. R. et al. Transforming Growth Factor β1 Suppresses the Type I Interferon Response and Induces Mitochondrial Dysfunction in Alveolar Macrophages. J Immunol 200, 2115–
2128 (2018).
39. Sohn, E. J. et al. TGF-β suppresses the expression of genes related to mitochondrial function in lung A549 cells. Cellular and molecular biology (Noisy-le-Grand, France) Suppl.58, OL1763-1767 (2012).
Supplementary data
Figure 1S
Figure 2S
Figure 1S. TMRM fluorescence signal in A549 cells. Cells were pre-incubated with 10μM CCCP or in standard medium for 10 min and then incubated with 25nM, 50nM, 100nM, 150nM and 200nM TMRM concentration.TMRM fluorescence was normalized by 10µM DRAQ5. Error bars indicate SEM. n=3 per group. Significant differences were obtained by 2way ANOVA with multiple comparison, Bonferroni post-test *P<0.05, **P<0.01, ***P<0.001.
Figure 3. B) TGF-β time-response assay of umbilical cords mesenchymal stem cells at time 0h with no TGF-β (vehicle), 12h, 24h, 36h and 48 with 10ng/ml TGF-β. B) TGF-β dosage-response assay of umbilical cords mesenchymal stem cells.
Mitochondrial membrane potential was measured with 300nM TMRM in presence of 0’1, 0’5, 1, 5, 10 and 50ng/ml TGF-β.
Fluorescence in both assays was measured with a 5µM CCCP pre-incubation too. TMRM fluorescence was normalized by 5µg/ml hoescht. Error bars indicate SEM. N=5,6 per group in A) and N=3 in B). Significant differences were obtained by 2way ANOVA with multiple comparison, Bonferroni post-test *P<0.05, ***P<0.001. * represents statistical differences between dosage or timepoint and no TGF-β condition and # represents statistical differences between CCCP group and
