Materials and methods

Specimens of black scabbardfish were collected in 2010 and 2011 at four different locations in NE Atlantic, namely Iceland, the west of the British Isles, mainland Portugal, and Madeira Island (Figure 3.1.1). Specimens from mainland Portugal and Madeira were caught by commercial longline vessels, whereas specimens from the other locations were collected with bottom trawl during the autumn survey conducted by the Icelandic Marine Research Institute and the deep-water survey held by the Marine Scotland. In Madeira, sampling took place in November to account for the peak in the reproductive period. Specimens from mainland Portugal were collected under the DCF - European Commission Fisheries Data Collection Framework during the last semester to comprise the months sampled in the other locations. Specimens were selected randomly to cover the ranges of total length and of maturity stages available at each sampling area (Table 3.1.1).

Figure 3.1.1. Map of NE Atlantic with the black scabbardfish sampling areas marked: triangles represent the sampling locations around Iceland; crosses, off west of the British Isles; circles, around Madeira Island; and squares, off mainland Portugal. The 1000 m depth contour is shown.

Table 3.1.1. Summary of the data regarding the black scabbardfish specimens used in FA and SI analyses.

Region Gear Depth (m) Year Month Sex Maturity TL (mm) n

Iceland bottom trawl (survey) 533-585 2010 11 F 1 920-960 4

M 1 880-1010 6

W British

Isles bottom trawl

(survey) 550-1650 2011 9

F 1 890-1080 3

2 910-1160 11

M 1 890-1010 2

2 920-1080 4

Mainland Portugal

bottom longline

(commercial)1100-1650 2010-2011 5-12

F

1 969-1001 3

2 990-1215 8

3 1212 1

M

1 980-1010 3

2 1007 1

3 1009-1119 4

Madeira

drifting horizontal

longline (commercial)

1200-1500 2010 11 F

2 1071-1164 7

3 1127-1358 6

4 1135-1323 2

5 1260-1345 5

The following information was collected for all specimens: total length (TL, in mm), sex, and maturity stage. Maturity stage was macroscopically assigned according to the scale proposed by Gordo et al.

(2000): stage I, immature or resting; stage II, developing; stage III, pre-spawning; stage IV, spawning;

and stage V, post-spawning or spent. For further data analyses, maturity stages were grouped as immature, which included stages I and II, and mature, which included stages III to V. Owing to constraints in sample availability, all specimens from Madeira were females.

White muscle samples from all study areas were extracted from the dorso-lateral region behind the head and frozen directly after collection. Afterwards, samples were freeze-dried and milled with a pestle and mortar. White muscle tissue was also collected from all sampled specimens for genetic analysis, being preserved in absolute ethanol at +4 ºC.

In specimens caught off mainland Portugal it was possible to collect 151 stomachs between May and December 2011. Each stomach was weighted and frozen at –20 ºC for further content analysis.

Genetic analysis

Molecular markers were used to guarantee that only specimens of A. carbo were considered in this study since misidentification problems with A. intermedius exist (Stefanni and Knutsen, 2007). The cytochrome oxidase subunit I (COI) gene from mitochondrial DNA was selected to identify the species. This gene has been shown to be adequate for discriminating between Aphanopus species (Stefanni et al., 2009) as well as to identify a wide number of vertebrate and invertebrate taxa (Hebert et al., 2003).

DNA was extracted from muscle tissue following the Qiagen DNeasy Tissue Kit protocol. Amplification of the 5’ end of the COI fragment was conducted in 25 µl reaction volumes containing ca. 50 ng of DNA sample, 10× reaction buffer, 1.5 mM MgCl², 0.2 nM dNTPs, 10 nM of each primer, and 0.1 U of Taq DNA Polymerase. The primers FishF1 (5´TCAACCAACCACAAAGACATTGGCAC3´)

and FishR1 (5´TAGACTTCTGGGTGGCCAAAGAATCA3´), designed by Ward et al. (2005), were used. The PCR thermal cycle consisted of an initial denaturing step of 5 min at 95 ºC, followed by 35 cycles of repeating the sequence 30 s at 95 ºC, 30 s at 50 ºC, and 60 s at 72 ºC, and a final extension step of 10 min at 72 ºC. The PCR products were enzymatically purified following a modification of the Exo-SAP method (Werle et al., 1994) and sequenced using the dye-labelled termination method (BigDye Terminator v3.1, Applied Biosystems, Inc., USA) on an ABI 3730XL sequencer (Macrogen Europe, The Netherlands). Amplicons were sequenced in both forward and reverse directions.

Sequences were aligned manually and edited using BioEdit (Hall, 1999).

The number of segregating sites, the number of haplotypes, and the haplotype and the nucleotide diversities (and standard deviation) were estimated using DnaSP 4.20.2 (Rozas et al., 2003). The sequence obtained for each specimen was compared with three sequences from A. carbo available in GenBank using the Blast service from the National Centre for Biotechnology Information (NCBI).

Diet analysis

The stomachs from specimens caught off mainland Portugal were defrosted at room temperature and the food categories were identified to the lowest possible taxonomic level, counted, weighted, and measured when possible. Each food category is further designated as prey.

The index of vacuity (%IV) was determined as the percentage of stomachs without food contents in the whole sample of stomachs. A stomach was considered to be without food contents when it was empty, everted, or only contained the bait. In mainland Portugal’s longline fishery the bait used was either Sardina pilchardus or Scomber colias.

The frequency of occurrence (%O, proportion between the number of stomachs containing a food category and the total number of stomachs with food items) was used to evaluate the relative importance of each prey in the diet of the black scabbardfish off mainland Portugal.

Fatty acids analysis

Fatty acid methyl esters (FAME) were prepared according to Bandarra et al. (2009), using 0.3 g of freeze-dried muscle tissue and 5 ml of the acetyl chloride:methanol mixture (1:19, v/v). The transesterification was carried out at 80 ºC for 1 h. After cooling, 1 ml of water and 2 ml of n-heptane were added to the mixture, which was stirred and centrifuged at 2.1×10⁴ m/s² for 10 min. The organic phase was collected, filtered and dried over anhydrous sodium sulphate. The solvent was removed under nitrogen and the FAME dissolved in 0.1 ml of n-heptane.

The FAME analyses were performed in a Varian CP-3800 (Walnut Creek, CA, USA) gas chromatograph equipped with an auto sampler and fitted with a flame ionization detector (GC-FID). The separation was carried out on an Omegawax (Supelco, USA) capillary column (25 m × 0.25 mm id). Temperature was programmed from 180 °C to 200 °C at 4 °C.min^-1, holding for 10 min at 200 °C and heating to 210 °C at 4 °C.min^-1, holding at 210 °C for 14.5 min with the injector and detector at 250 °C. Methyl esters were quantified using the Varian software.

Thirty-nine fatty acids comprised the array of identified FA chosen for this study. Values were expressed as percentage of total area of all identified FA (% of total FA).

Stable isotopes analysis

To evaluate the carbon and the nitrogen isotope ratios (δ¹³C and δ¹⁵N, respectively) approximately 2 mg of powdered lyophilised muscle was weighted into a tin capsule. For quality control purposes, for each specimen two duplicates were prepared, randomly ordered and one standard was analysed at every fifth sample. The isotope ratios δ¹³C and δ¹⁵N were determined by continuous-flow isotope ratio mass spectrometry (CF-IRMS) using a Finnigan ConFlo III coupled to a Flash Elemental Analyser 1112 Series (Thermo Electron Corporation, USA). The results were reported in δ notation according to the equation

where X is ¹³C or ¹⁵N and R is the ratio ¹³C/¹²C or ¹⁵N/¹⁴N in the sample and in the standard. δ¹³C and δ¹⁵N were expressed as per mill (‰) relative to Vienna-Pee Dee Belemnite (V-PDB) and atmospheric N₂ (air), respectively. These compounds are defined as the 0‰ point of the δ scale. The precision of the method was inferior to 0.1‰ for both isotope ratios.

Part of the variability in δ¹³C in biological matrices is associated with varying lipid content amongst samples, since lipids are isotopically depleted in ¹³C relative to proteins and carbohydrates (DeNiro and Epstein, 1977). The common approach to correct this effect is removing lipids from biological samples (Post, 2002; Sweeting et al., 2006). However, lipid extraction implies an undesirable and unintended enrichment of the sample in ¹⁵N (Hoffman and Sutton, 2010). Therefore, to optimize this analysis in terms of time and costs, the method proposed by Hoffman and Sutton (2010) to correct the effect of lipids on δ¹³C of untreated tissue was followed:

For deep-sea fish, the isotopic depletion factor is Δδ¹³C^lipid = –6.39‰, whereas the ratio C:N^protein = 3.76 reflects the carbon mass balance given that simple lipids do not contain nitrogen (Hoffman and Sutton, 2010).

Data analyses

Canonical cluster analysis (CCA) was used for exploratory analysis of the most abundant fatty acids found in the muscle of black scabbardfish regarding the factors region, sex, maturity stage, and total length. The CCA is a combination of ordination and regression methods that allows extracting the synthetic gradients (ordination axes) that maximise the separation between FA and the levels of the four factors under analysis (ter Braak, 1985).

Posteriorly, the following sums were calculated for each specimen: SFA, as the sum of all saturated fatty acids; MUFA, as the sum of all monounsaturated FA; and PUFA, as the sum of all polyunsaturated FA. The importance of the different FA groups relies on the fact that each can be associated to particular physiological metabolic processes (Bandarra et al., 2009; Huynh and Kitts, 2009). Linear-mixed model (LMM) was fitted to each FA group (SFA, MUFA, and PUFA) by restricted maximum likelihood, considering region, sex, and maturity stage as fixed effects and TL as random effect. The LMM was chosen to allow removing the effect of the different TL range by area.

LMM was also fitted to PUFA with mean values higher than 1.00% of total FA in all areas by restricted maximum likelihood, considering region, sex and maturity stage as fixed effects and TL as random effect.

The correlation between δ¹⁵N and δ¹³C and TL by area was estimated through the Pearson’s correlation coefficient. LMM was fitted to δ¹⁵N and δ¹³C separately by restricted maximum likelihood, considering region, sex and maturity stage as fixed effects and TL as random effect.

For all LMM, the function ‘lme’ from library ‘nlme’ version 3.1-113 was used (Pinheiro and Bates, 2000). The following assumptions for LMM were assessed by graphical analyses: (i) the within-group errors are independent and identically distributed, with mean zero and variance σ², and are independent of the random effects; (ii) the random effects are normally distributed and are independent for different groups (Pinheiro and Bates, 2000).

All data analyses where performed in R version 3.0.2.