• No results found

100000 cellules sont cytocentrifugées sur lames avant d’être fixées pendant 15 minutes. Pour le cytochrome c et EndoG, les cellules sont fixées par la paraformaldéhyde (4%), lavées en PBS et perméabilisées pendant 15 minutes en présence de Triton X-100 (0.1%). Pour AIF, les cellules sont fixées en présence de méthanol (100%) à -20°C puis lavées en PBS et incubées pendant 15 minutes avec de la BSA (3%). Après lavage, les lames

secondaire anti-IgG de souris couplé au FITC (4µg/ml, Molecular Probes). Les lames sont ensuite analysées par microscopie confocale

.

VIII- Analyse des sphingolipides

VIII-1 Extraction lipidique

Les culots cellulaires sont repris par 200 µl d’eau distillée et homogénéisés par sonication. 30 µl sont conservés pour le dosage protéique par la méthode de Bradford. 850 µl de chloroforme/méthanol (2 :1, v/v) sont ajoutés au 170 µl d’extraits restant. Après mélange et centrifugation à 2500 rpm pendant 15 minutes, la phase inférieure est récupérée et lavée avec une phase supérieure synthétique constituée de chloroforme/méthanol/eau (3 :48 :47, v/v/v), puis évaporée sous azote.

VIII-2 Dosage du céramide (méthode de la DAG kinase)

Le principe de la méthode repose sur la capacité de la DAG kinase à phosphoryler le DAG et le céramide. Les extraits lipidiques sont solubilisés par 40 µl de solution détergente (di-oléoyl-phosphatidyl-glycérol/octyl-β-glucoside), vortexés, soniqués et incubés en présence de DAG Kinase d’E.coli (isolée à partir de bactéries fournies par les Drs. D. Perry et Y.A. Hannun (Charleston, SC)) et d’ATPγP32 à température ambiante pendant 30 minutes. La réaction est stoppée par l’addition de 250 µl d’eau contenant 1% d’acide perchlorique, 400 µl de chloroforme et 400 µl de méthanol. Une centrifugation à 2500 rpm pendant 10 minutes permet d’isoler la phase inférieure contenant le céramide-1-phosphate et l’acide phosphatidique. La phase inférieure est ensuite évaporée sous azote puis solubilisée par 60 µl de chloroforme/méthanol (2:1, v/v). 20 µl de cet extrait sont séparés sur une plaque de silice dans un système de migration contenant chloroforme/acétone/méthanol/acide acétique/eau (50:20:15:10:5, v/v/v/v/v). Les bandes correspondant au céramide-1-phosphate et à l’acide phosphatidique sont révélées par autoradiographie, grattées et comptées par scintillation.

VIII-3 Analyse du profil sphingolipidique

3 millions de cellules Jurkat sont incubées en présence de [3H]-sphingosine (0,33 µCi/ml) (PerkinElmer), un précurseur de la synthèse des sphingolipides, pendant 48 heures ou 72 heures pour marquer les sphingolipides à l’équilibre. Après 2 heures de « chasse » (incubation des cellules en présence d’un milieu non radioactif), les cellules sont incubées en présence de FasL aux concentrations et pendant les temps indiqués avant d’être récoltées et centrifugées à 1500 rpm. Les lipides sont extraits à partir des culots cellulaires (cf chapitre VIII-1). Les résidus lipidiques sont repris par 20 µl de chloroforme/méthanol (2 :1, v/v) puis séparés par chromatographie sur couche mince dans un système de migration contenant chloroforme/méthanol/eau (100:42:6, v/v/v). La distribution des sphingolipides radiomarqués sur la plaque de chromatographie est analysée grâce à un radiochromatoscanner (Bertold). Des lipides standards permettent d’identifier les différents sphingolipides qui sont ensuite grattés puis quantifiés par scintillation.

Dosage de la sphingomyéline (SM) et des PC(phosphatidylcholine) :

Alternativement, 3 millions de cellules sont incubées en présence de [3H]-choline (1µCi/ml) (PerkinElmer) pendant 48 à 72 heures pour permettre le marquage de la SM et des PC à l’équilibre. La SM et les PC radiomarqués sont ensuite séparés par méthanolyse alcaline. Ainsi, après extraction lipidique (cf chapitre VIII-1), les résidus lipidiques sont solubilisés dans 84µl de chloroforme et 84µl de soude méthanolique 0,5 M. Le mélange est incubé à 37°C pendant 2 heures sous agitation et la réaction de méthanolyse est arrêtée par l’ajout de 84µl d’acide chlorhydrique méthanolique (HCl 0,5 M), 144 µl d’eau, 284 µl de chloroforme et 167 µl de chloroforme/méthanol (2 :1, v/v). Après mélange et centrifugation à 2500 rpm pendant 10 minutes, la phase supérieure contenant la glycérophosphocholine marquée est comptée par scintillation. La phase inférieure contenant la SM radioactive est lavée deux fois par une phase supérieure synthétique constituée de chloroforme/méthanol/eau (3 :48 :47, v/v/v) avant d’être évaporée sous azote et comptée par scintillation liquide.

non de FasL pendant les temps indiqués avant d’être récoltées et centrifugées à 1200 rpm à 4°C. Les culots cellulaires sont immédiatement congelés à -20°C. Les PC et la SM radiomarqués sont quantifiés après la réaction de méthanolyse alcaline comme décrit précédemment (cf chapitre VIII-3).

VIII-5 Dosage des activités enzymatiques de la SMS et de la GCS

In situ : Les activités de la SMS et GCS sont évaluées en culture par la quantification

de la conversion de C6-NBD-Céramide en C6-NBD-SM et C6-NBD-GlcCer. 1 million de cellules Jurkat sont incubées dans 1ml de RPMI 10 % SVF et 2,5 µM de C6-NBD-Céramide (Sigma) pendant 2 heures à 37°C. L’ajout de 5 ml de chloroforme/méthanol (2 :1, v/v) permet d’arrêter la réaction. Les lipides sont extraits par une centrifugation à 2500 rpm pendant 10 minutes permettant la séparation de la phase inférieure lipidique qui est ensuite évaporée sous azote. Les lipides sont solubilisés par 20 µl de chloroforme/méthanol (2 :1, v/v) et séparés par chromatographie sur couche mince dans un système de migration contenant chloroforme/méthanol/30%Ammoniac (70 :30 :5, v/v/v). Les bandes correspondant au C6-NBD-Ceramide, au C6-NBD-SM et au C6-NBD-GlcCer sont révélées sous UV, solubilisées dans 1 ml de chloroforme/méthanol (1 :1, v/v) puis quantifiées par spectrofluorimétrie (λexcitation = 470 nm ; λémission = 530 nm).

In vitro : 100 µg d’extraits protéiques de cellules traitées par FasL sont repris dans

250 µl de tampon de réaction contenant MgCl2 (5 mM), MnCl2 (5 mM), EDTA (1 mM),

Hépès (50 mM). Le mélange est incubé en présence de 250 µl de substrat contenant 400 µM de PC (Sigma), 5µM de C6-NBD-Ceramide et 400 µM de UDP-Glucose pendant 30 minutes à 37°C. La réaction est arrêtée avec 2,5 ml de chloroforme/méthanol (2 :1, v/v). Puis le mélange réactionnel est centrifugé 10 minutes à 2500 rpm. La phase inférieure est évaporée sous azote. Les lipides sont séparés par chromatographie sur couche mince comme décrit pour le dosage in vitro.

IX- Analyse de l’expression des ARNm

L’ARN total est isolé à partir de cellules Jurkat grâce au kit QIAGEN RNeasy kit (Qiagen) et soumis à une réverse transcription en utilisant des oligo(dT)15 (Promega) et Superscript II (Invitrogen). Les ADNc obtenus sont analysés par PCR (Polymerase Chain Reaction) en temps réel en utilisant des primers spécifiques de la SMS1, SMS2 et GAPDH

(Qiagen) et un Master mix Power SYBR Green PCR (Applied biosystem). L’amplification est effectuée grâce à un Taqman 7900 (Applied biosystem).

Alternativement, les ADNc sont amplifiés par 30 cycles de PCR en utilisant GoTaq Flexi DNA Polymerase (Promega) et des primers specifiques pour la SMS1 (primer sens : CATTTCAACTGTTCTCCGAAGC; primer antisens : CCATAGTGTGATACCACCAG), la

SMS2 (primer sens :TTAATCTGCTGGCTGCTGAG; primer antisens :

ACCAATCTTCTGAACCCGTG) et GAPDH (primer sens :

AACATCATCCCTGCCTCTACTG ; primer antisens :

TTGACAAAGTGGTCGTTGAGG). Des ADNc isolés à partir de fibroblastes de peau humaine et des vecteurs codant pour les ADNc de la SMS1 et SMS2 sont utilisés comme contrôles positifs. Les amplifications sont réalisées dans un thermal Cycler (Biorad) et les produits d’amplifications sont analysés par migration sur un gel d’agarose 0,8 % et une coloration au bromure d’éthidium.

X- Anticorps et autres réactifs

La concentration ou la dilution utilisée est indiquée. z-VAD(OMe)-fmk (40µM) et z- AE(OMe)-VD(OMe)-fmk (10 µM) (Bachem), D609 (50 µg/ml) (Sigma).

Anticorps : Anti-FADD (clone A66-2, 0,5 µg/ml, BD Biosciences), anti-Caspase-8 (clone B9-2, 0,5 µg/ml, BD Biosciences), anti-Bcl-xL (clone 2H12, 1µg/ml, BD Biosciences), anti- Caspase-10 (clone 4C1, 1µg/ml, MBL), anti-Caspase-3 polyclonal (10µg/ml, DAKO), anti- Caspase-7 polyclonal (1/1000, Cell Signaling Technology), anti-PARP polyclonal (1/1000, Cell Signaling Technology), anti-PARP clivé (clone 19F4, 1/1000, Cell Signaling Technology), anti-Bid polyclonal (1/1000, Cell Signaling Technology), anti-cytochrome c pour Western-blot (clone 7H8.2C12, 1µg/ml, BD Biosciences), anti-Rip monoclonal (1/1000, BD Biosciences), anti-CCTα (clone 7H8, 1/1000, Abnova), anti-β-Actine (clone AC-15, 5µg/ml, Sigma).

Adams, J.M. (2003) Ways of dying: multiple pathways to apoptosis. Genes Dev, 17, 2481- 2495.

Ahn, H.J., Kim, Y.S., Kim, J.U., Han, S.M., Shin, J.W. and Yang, H.O. (2004) Mechanism of taxol-induced apoptosis in human SKOV3 ovarian carcinoma cells. J Cell Biochem, 91, 1043-1052.

Alcouffe, J., Therville, N., Segui, B., Nazzal, D., Blaes, N., Salvayre, R., Thomsen, M. and Benoist, H. (2004) Expression of membrane-bound and soluble FasL in Fas- and FADD-dependent T lymphocyte apoptosis induced by mildly oxidized LDL. Faseb J, 18, 122-124.

Alderson, M.R., Armitage, R.J., Maraskovsky, E., Tough, T.W., Roux, E., Schooley, K., Ramsdell, F. and Lynch, D.H. (1993) Fas transduces activation signals in normal human T lymphocytes. J Exp Med, 178, 2231-2235.

Algeciras-Schimnich, A., Shen, L., Barnhart, B.C., Murmann, A.E., Burkhardt, J.K. and Peter, M.E. (2002) Molecular ordering of the initial signaling events of CD95. Mol

Cell Biol, 22, 207-220.

Alphonse, G., Bionda, C., Aloy, M.T., Ardail, D., Rousson, R. and Rodriguez-Lafrasse, C. (2004) Overcoming resistance to gamma-rays in squamous carcinoma cells by poly- drug elevation of ceramide levels. Oncogene, 23, 2703-2715.

Andrieu-Abadie, N., Gouaze, V., Salvayre, R. and Levade, T. (2001) Ceramide in apoptosis signaling: relationship with oxidative stress. Free Radic Biol Med, 31, 717-728. Armstrong, J.S. (2006) The role of the mitochondrial permeability transition in cell death.

Mitochondrion, 6, 225-234.

Arnoult, D., Gaume, B., Karbowski, M., Sharpe, J.C., Cecconi, F. and Youle, R.J. (2003) Mitochondrial release of AIF and EndoG requires caspase activation downstream of Bax/Bak-mediated permeabilization. Embo J, 22, 4385-4399.

Azuma, H., Takahara, S., Ichimaru, N., Wang, J.D., Itoh, Y., Otsuki, Y., Morimoto, J., Fukui, R., Hoshiga, M., Ishihara, T., Nonomura, N., Suzuki, S., Okuyama, A. and Katsuoka, Y. (2002) Marked prevention of tumor growth and metastasis by a novel

immunosuppressive agent, FTY720, in mouse breast cancer models. Cancer Res, 62, 1410-1419.

Backes, C., Kuentzer, J., Lenhof, H.P., Comtesse, N. and Meese, E. (2005) GraBCas: a bioinformatics tool for score-based prediction of Caspase- and Granzyme B-cleavage sites in protein sequences. Nucleic Acids Res, 33, W208-213.

Bao, Q. and Shi, Y. (2007) Apoptosome: a platform for the activation of initiator caspases.

Cell Death Differ, 14, 56-65.

Barnhart, B.C., Legembre, P., Pietras, E., Bubici, C., Franzoso, G. and Peter, M.E. (2004) CD95 ligand induces motility and invasiveness of apoptosis-resistant tumor cells.

Embo J, 23, 3175-3185.

Beaujouin, M., Baghdiguian, S., Glondu-Lassis, M., Berchem, G. and Liaudet-Coopman, E. (2006) Overexpression of both catalytically active and -inactive cathepsin D by cancer cells enhances apoptosis-dependent chemo-sensitivity. Oncogene, 25, 1967- 1973.

Beltinger, C., Kurz, E., Bohler, T., Schrappe, M., Ludwig, W.D. and Debatin, K.M. (1998) CD95 (APO-1/Fas) mutations in childhood T-lineage acute lymphoblastic leukemia.

Bi, L.L., Pan, G., Atkinson, T.P., Zheng, L., Dale, J.K., Makris, C., Reddy, V., McDonald, J.M., Siegel, R.M., Puck, J.M., Lenardo, M.J. and Straus, S.E. (2007) Dominant inhibition of Fas ligand-mediated apoptosis due to a heterozygous mutation associated with autoimmune lymphoproliferative syndrome (ALPS) Type Ib. BMC Med Genet, 8, 41.

Bidere, N., Lorenzo, H.K., Carmona, S., Laforge, M., Harper, F., Dumont, C. and Senik, A. (2003) Cathepsin D triggers Bax activation, resulting in selective apoptosis-inducing factor (AIF) relocation in T lymphocytes entering the early commitment phase to apoptosis. J Biol Chem, 278, 31401-31411.

Bionda, C., Portoukalian, J., Schmitt, D., Rodriguez-Lafrasse, C. and Ardail, D. (2004) Subcellular compartmentalization of ceramide metabolism: MAM (mitochondria- associated membrane) and/or mitochondria? Biochem J, 382, 527-533.

Birbes, H., El Bawab, S., Hannun, Y.A. and Obeid, L.M. (2001) Selective hydrolysis of a mitochondrial pool of sphingomyelin induces apoptosis. Faseb J, 15, 2669-2679. Boatright, K.M., Deis, C., Denault, J.B., Sutherlin, D.P. and Salvesen, G.S. (2004) Activation

of caspases-8 and -10 by FLIP(L). Biochem J, 382, 651-657.

Boatright, K.M., Renatus, M., Scott, F.L., Sperandio, S., Shin, H., Pedersen, I.M., Ricci, J.E., Edris, W.A., Sutherlin, D.P., Green, D.R. and Salvesen, G.S. (2003) A unified model for apical caspase activation. Mol Cell, 11, 529-541.

Boatright, K.M. and Salvesen, G.S. (2003) Mechanisms of caspase activation. Curr Opin Cell

Biol, 15, 725-731.

Boise, L.H. and Thompson, C.B. (1997) Bcl-x(L) can inhibit apoptosis in cells that have undergone Fas-induced protease activation. Proc Natl Acad Sci U S A, 94, 3759-3764. Bollinger, C.R., Teichgraber, V. and Gulbins, E. (2005) Ceramide-enriched membrane

domains. Biochim Biophys Acta, 1746, 284-294.

Bonhoure, E., Pchejetski, D., Aouali, N., Morjani, H., Levade, T., Kohama, T. and Cuvillier, O. (2006) Overcoming MDR-associated chemoresistance in HL-60 acute myeloid leukemia cells by targeting sphingosine kinase-1. Leukemia, 20, 95-102.

Bosque, A., Aguilo, J.I., Alava, M.A., Paz-Artal, E., Naval, J., Allende, L.M. and Anel, A. (2007) The induction of Bim expression in human T-cell blasts is dependent on nonapoptotic Fas/CD95 signaling. Blood, 109, 1627-1635.

Broker, L.E., Huisman, C., Span, S.W., Rodriguez, J.A., Kruyt, F.A. and Giaccone, G. (2004) Cathepsin B mediates caspase-independent cell death induced by microtubule

stabilizing agents in non-small cell lung cancer cells. Cancer Res, 64, 27-30. Brunner, T., Mogil, R.J., LaFace, D., Yoo, N.J., Mahboubi, A., Echeverri, F., Martin, S.J.,

Force, W.R., Lynch, D.H., Ware, C.F. and et al. (1995) Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature, 373, 441-444.

Budd, R.C. (2001) Activation-induced cell death. Curr Opin Immunol, 13, 356-362. Callus, B.A. and Vaux, D.L. (2007) Caspase inhibitors: viral, cellular and chemical. Cell

Death Differ, 14, 73-78.

Carter, B.Z., Kornblau, S.M., Tsao, T., Wang, R.Y., Schober, W.D., Milella, M., Sung, H.G., Reed, J.C. and Andreeff, M. (2003) Caspase-independent cell death in AML: caspase inhibition in vitro with pan-caspase inhibitors or in vivo by XIAP or Survivin does not affect cell survival or prognosis. Blood, 102, 4179-4186.

Cauwels, A., Janssen, B., Waeytens, A., Cuvelier, C. and Brouckaert, P. (2003) Caspase inhibition causes hyperacute tumor necrosis factor-induced shock via oxidative stress and phospholipase A2. Nat Immunol, 4, 387-393.

Chakrabandhu, K., Herincs, Z., Huault, S., Dost, B., Peng, L., Conchonaud, F., Marguet, D., He, H.T. and Hueber, A.O. (2007) Palmitoylation is required for efficient Fas cell death signaling. Embo J, 26, 209-220.

Chalfant, C.E., Ogretmen, B., Galadari, S., Kroesen, B.J., Pettus, B.J. and Hannun, Y.A. (2001) FAS activation induces dephosphorylation of SR proteins; dependence on the de novo generation of ceramide and activation of protein phosphatase 1. J Biol Chem, 276, 44848-44855.

Chang, D.W., Xing, Z., Capacio, V.L., Peter, M.E. and Yang, X. (2003) Interdimer processing mechanism of procaspase-8 activation. Embo J, 22, 4132-4142.

Chang, D.W., Xing, Z., Pan, Y., Algeciras-Schimnich, A., Barnhart, B.C., Yaish-Ohad, S., Peter, M.E. and Yang, X. (2002) c-FLIP(L) is a dual function regulator for caspase-8 activation and CD95-mediated apoptosis. Embo J, 21, 3704-3714.

Chang, H.Y., Nishitoh, H., Yang, X., Ichijo, H. and Baltimore, D. (1998) Activation of apoptosis signal-regulating kinase 1 (ASK1) by the adapter protein Daxx. Science, 281, 1860-1863.

Chang, H.Y., Yang, X. and Baltimore, D. (1999) Dissecting Fas signaling with an altered- specificity death-domain mutant: requirement of FADD binding for apoptosis but not Jun N-terminal kinase activation. Proc Natl Acad Sci U S A, 96, 1252-1256.

Chautan, M., Chazal, G., Cecconi, F., Gruss, P. and Golstein, P. (1999) Interdigital cell death can occur through a necrotic and caspase-independent pathway. Curr Biol, 9, 967- 970.

Chen, M., Orozco, A., Spencer, D.M. and Wang, J. (2002) Activation of initiator caspases through a stable dimeric intermediate. J Biol Chem, 277, 50761-50767.

Cheng, E.H., Wei, M.C., Weiler, S., Flavell, R.A., Mak, T.W., Lindsten, T. and Korsmeyer, S.J. (2001) BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAK-mediated mitochondrial apoptosis. Mol Cell, 8, 705-711.

Cheng, J., Zhou, T., Liu, C., Shapiro, J.P., Brauer, M.J., Kiefer, M.C., Barr, P.J. and Mountz, J.D. (1994) Protection from Fas-mediated apoptosis by a soluble form of the Fas molecule. Science, 263, 1759-1762.

Chhabra, A., Mehrotra, S., Chakraborty, N.G., Dorsky, D.I. and Mukherji, B. (2006)

Activation-induced cell death of human melanoma specific cytotoxic T lymphocytes is mediated by apoptosis-inducing factor. Eur J Immunol, 36, 3167-3174.

Chiba, K. (2005) FTY720, a new class of immunomodulator, inhibits lymphocyte egress from secondary lymphoid tissues and thymus by agonistic activity at sphingosine 1- phosphate receptors. Pharmacol Ther, 108, 308-319.

Chinnaiyan, A.M., O'Rourke, K., Tewari, M. and Dixit, V.M. (1995) FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell, 81, 505-512.

Chipuk, J.E. and Green, D.R. (2005) Do inducers of apoptosis trigger caspase-independent cell death? Nat Rev Mol Cell Biol, 6, 268-275.

Chua, C.W., Lee, D.T., Ling, M.T., Zhou, C., Man, K., Ho, J., Chan, F.L., Wang, X. and Wong, Y.C. (2005) FTY720, a fungus metabolite, inhibits in vivo growth of androgen-independent prostate cancer. Int J Cancer, 117, 1039-1048.

involvement of phosphatidylcholine-specific phospholipase C and acidic

sphingomyelinase in the propagation of the apoptotic signal. Embo J, 14, 5859-5868. Cock, J.G., Tepper, A.D., de Vries, E., van Blitterswijk, W.J. and Borst, J. (1998) CD95

(Fas/APO-1) induces ceramide formation and apoptosis in the absence of a functional acid sphingomyelinase. J Biol Chem, 273, 7560-7565.

Cohen, G.M. (1997) Caspases: the executioners of apoptosis. Biochem J, 326 (Pt 1), 1-16. Cory, S. and Adams, J.M. (2002) The Bcl2 family: regulators of the cellular life-or-death

switch. Nat Rev Cancer, 2, 647-656.

Crawford, K.W., Bittman, R., Chun, J., Byun, H.S. and Bowen, W.D. (2003) Novel ceramide analogues display selective cytotoxicity in drug-resistant breast tumor cell lines compared to normal breast epithelial cells. Cell Mol Biol (Noisy-le-grand), 49, 1017- 1023.

Cremesti, A., Paris, F., Grassme, H., Holler, N., Tschopp, J., Fuks, Z., Gulbins, E. and Kolesnick, R. (2001) Ceramide enables fas to cap and kill. J Biol Chem, 276, 23954- 23961.

Cuvillier, O. (2002) Sphingosine in apoptosis signaling. Biochim Biophys Acta, 1585, 153- 162.

Cuvillier, O. (2007) Sphingosine kinase-1--a potential therapeutic target in cancer.

Anticancer Drugs, 18, 105-110.

Cuvillier, O., Edsall, L. and Spiegel, S. (2000) Involvement of sphingosine in mitochondria- dependent Fas-induced apoptosis of type II Jurkat T cells. J Biol Chem, 275, 15691- 15700.

Cuvillier, O. and Levade, T. (2001) Sphingosine 1-phosphate antagonizes apoptosis of human leukemia cells by inhibiting release of cytochrome c and Smac/DIABLO from

mitochondria. Blood, 98, 2828-2836.

Cuvillier, O., Nava, V.E., Murthy, S.K., Edsall, L.C., Levade, T., Milstien, S. and Spiegel, S. (2001) Sphingosine generation, cytochrome c release, and activation of caspase-7 in doxorubicin-induced apoptosis of MCF7 breast adenocarcinoma cells. Cell Death

Differ, 8, 162-171.

Cuvillier, O., Pirianov, G., Kleuser, B., Vanek, P.G., Coso, O.A., Gutkind, S. and Spiegel, S. (1996) Suppression of ceramide-mediated programmed cell death by sphingosine-1- phosphate. Nature, 381, 800-803.

Cuvillier, O., Rosenthal, D.S., Smulson, M.E. and Spiegel, S. (1998) Sphingosine 1- phosphate inhibits activation of caspases that cleave poly(ADP-ribose) polymerase and lamins during Fas- and ceramide-mediated apoptosis in Jurkat T lymphocytes. J

Biol Chem, 273, 2910-2916.

d'Azzo, A., Tessitore, A. and Sano, R. (2006) Gangliosides as apoptotic signals in ER stress response. Cell Death Differ, 13, 404-414.

Dagan, A., Wang, C., Fibach, E. and Gatt, S. (2003) Synthetic, non-natural sphingolipid analogs inhibit the biosynthesis of cellular sphingolipids, elevate ceramide and induce apoptotic cell death. Biochim Biophys Acta, 1633, 161-169.

Daido, S., Kanzawa, T., Yamamoto, A., Takeuchi, H., Kondo, Y. and Kondo, S. (2004) Pivotal role of the cell death factor BNIP3 in ceramide-induced autophagic cell death in malignant glioma cells. Cancer Res, 64, 4286-4293.

Davidson, W.F., Haudenschild, C., Kwon, J. and Williams, M.S. (2002) T cell receptor ligation triggers novel nonapoptotic cell death pathways that are Fas-independent or Fas-dependent. J Immunol, 169, 6218-6230.

Dbaibo, G.S., Kfoury, Y., Darwiche, N., Panjarian, S., Kozhaya, L., Nasr, R., Abdallah, M., Hermine, O., El-Sabban, M., de The, H. and Bazarbachi, A. (2007) Arsenic trioxide induces accumulation of cytotoxic levels of ceramide in acute promyelocytic

leukemia and adult T-cell leukemia/lymphoma cells through de novo ceramide synthesis and inhibition of glucosylceramide synthase activity. Haematologica, 92, 753-762.

De Maria, R., Lenti, L., Malisan, F., d'Agostino, F., Tomassini, B., Zeuner, A., Rippo, M.R. and Testi, R. (1997) Requirement for GD3 ganglioside in CD95- and ceramide- induced apoptosis. Science, 277, 1652-1655.

Degterev, A., Huang, Z., Boyce, M., Li, Y., Jagtap, P., Mizushima, N., Cuny, G.D., Mitchison, T.J., Moskowitz, M.A. and Yuan, J. (2005) Chemical inhibitor of

nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nat Chem

Biol, 1, 112-119.

Del-Rey, M., Ruiz-Contreras, J., Bosque, A., Calleja, S., Gomez-Rial, J., Roldan, E., Morales, P., Serrano, A., Anel, A., Paz-Artal, E. and Allende, L.M. (2006) A

homozygous Fas ligand gene mutation in a patient causes a new type of autoimmune lymphoproliferative syndrome. Blood, 108, 1306-1312.

Denecker, G., Vercammen, D., Steemans, M., Vanden Berghe, T., Brouckaert, G., Van Loo, G., Zhivotovsky, B., Fiers, W., Grooten, J., Declercq, W. and Vandenabeele, P. (2001) Death receptor-induced apoptotic and necrotic cell death: differential role of caspases and mitochondria. Cell Death Differ, 8, 829-840.

Devadas, S., Das, J., Liu, C., Zhang, L., Roberts, A.I., Pan, Z., Moore, P.A., Das, G. and Shi, Y. (2006) Granzyme B is critical for T cell receptor-induced cell death of type 2 helper T cells. Immunity, 25, 237-247.

Dhein, J., Walczak, H., Baumler, C., Debatin, K.M. and Krammer, P.H. (1995) Autocrine T- cell suicide mediated by APO-1/(Fas/CD95). Nature, 373, 438-441.

Dindo, D., Dahm, F., Szulc, Z., Bielawska, A., Obeid, L.M., Hannun, Y.A., Graf, R. and Clavien, P.A. (2006) Cationic long-chain ceramide LCL-30 induces cell death by mitochondrial targeting in SW403 cells. Mol Cancer Ther, 5, 1520-1529.

Dobo, J., Swanson, R., Salvesen, G.S., Olson, S.T. and Gettins, P.G. (2006) Cytokine response modifier a inhibition of initiator caspases results in covalent complex formation and dissociation of the caspase tetramer. J Biol Chem, 281, 38781-38790. Doerfler, P., Forbush, K.A. and Perlmutter, R.M. (2000) Caspase enzyme activity is not

essential for apoptosis during thymocyte development. J Immunol, 164, 4071-4079. Dolgachev, V., Farooqui, M.S., Kulaeva, O.I., Tainsky, M.A., Nagy, B., Hanada, K. and

Separovic, D. (2004) De novo ceramide accumulation due to inhibition of its

conversion to complex sphingolipids in apoptotic photosensitized cells. J Biol Chem, 279, 23238-23249.

Donepudi, M., Mac Sweeney, A., Briand, C. and Grutter, M.G. (2003) Insights into the regulatory mechanism for caspase-8 activation. Mol Cell, 11, 543-549.

Elojeimy, S., Liu, X., McKillop, J.C., El-Zawahry, A.M., Holman, D.H., Cheng, J.Y., Meacham, W.D., Mahdy, A.E., Saad, A.F., Turner, L.S., Cheng, J., T, A.D., Dong, J.Y., Bielawska, A., Hannun, Y.A. and Norris, J.S. (2007) Role of Acid Ceramidase in Resistance to FasL: Therapeutic Approaches Based on Acid Ceramidase Inhibitors and FasL Gene Therapy. Mol Ther, 15, 1259-1263.

Engedal, N. and Saatcioglu, F. (2001) Ceramide-induced cell death in the prostate cancer cell line LNCaP has both necrotic and apoptotic features. Prostate, 46, 289-297.

Feig, C., Tchikov, V., Schutze, S. and Peter, M.E. (2007) Palmitoylation of CD95 facilitates formation of SDS-stable receptor aggregates that initiate apoptosis signaling. Embo J, 26, 221-231.

Fernandes-Alnemri, T., Armstrong, R.C., Krebs, J., Srinivasula, S.M., Wang, L., Bullrich, F., Fritz, L.C., Trapani, J.A., Tomaselli, K.J., Litwack, G. and Alnemri, E.S. (1996) In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains. Proc Natl Acad Sci U S A, 93, 7464- 7469.

Ferri, K.F. and Kroemer, G. (2001) Organelle-specific initiation of cell death pathways. Nat

Cell Biol, 3, E255-263.

Fiebig, A.A., Zhu, W., Hollerbach, C., Leber, B. and Andrews, D.W. (2006) Bcl-XL is qualitatively different from and ten times more effective than Bcl-2 when expressed in a breast cancer cell line. BMC Cancer, 6, 213.

Filomenko, R., Prevotat, L., Rebe, C., Cortier, M., Jeannin, J.F., Solary, E. and Bettaieb, A. (2006) Caspase-10 involvement in cytotoxic drug-induced apoptosis of tumor cells.

Oncogene, 25, 7635-7645.

Fischer, U., Stroh, C. and Schulze-Osthoff, K. (2006) Unique and overlapping substrate specificities of caspase-8 and caspase-10. Oncogene, 25, 152-159.

French, K.J., Schrecengost, R.S., Lee, B.D., Zhuang, Y., Smith, S.N., Eberly, J.L., Yun, J.K. and Smith, C.D. (2003) Discovery and evaluation of inhibitors of human sphingosine kinase. Cancer Res, 63, 5962-5969.

Fuentes-Prior, P. and Salvesen, G.S. (2004) The protein structures that shape caspase activity, specificity, activation and inhibition. Biochem J, 384, 201-232.

Futerman, A.H. and Hannun, Y.A. (2004) The complex life of simple sphingolipids. EMBO

Rep, 5, 777-782.

Futerman, A.H. and Riezman, H. (2005) The ins and outs of sphingolipid synthesis. Trends

Cell Biol, 15, 312-318.

Gabriel, B., Sureau, F., Casselyn, M., Teissie, J. and Petit, P.X. (2003) Retroactive pathway involving mitochondria in electroloaded cytochrome c-induced apoptosis. Protective properties of Bcl-2 and Bcl-XL. Exp Cell Res, 289, 195-210.

Gallego, M.A., Joseph, B., Hemstrom, T.H., Tamiji, S., Mortier, L., Kroemer, G.,

Formstecher, P., Zhivotovsky, B. and Marchetti, P. (2004) Apoptosis-inducing factor determines the chemoresistance of non-small-cell lung carcinomas. Oncogene, 23, 6282-6291.

Garcia-Calvo, M., Peterson, E.P., Leiting, B., Ruel, R., Nicholson, D.W. and Thornberry, N.A. (1998) Inhibition of human caspases by peptide-based and macromolecular inhibitors. J Biol Chem, 273, 32608-32613.

Garofalo, T., Giammarioli, A.M., Misasi, R., Tinari, A., Manganelli, V., Gambardella, L., Pavan, A., Malorni, W. and Sorice, M. (2005) Lipid microdomains contribute to apoptosis-associated modifications of mitochondria in T cells. Cell Death Differ, 12, 1378-1389.

Garofalo, T., Misasi, R., Mattei, V., Giammarioli, A.M., Malorni, W., Pontieri, G.M., Pavan, A. and Sorice, M. (2003) Association of the death-inducing signaling complex with microdomains after triggering through CD95/Fas. Evidence for caspase-8-ganglioside