• No results found

andre_knutsen_Cons_Gen_Res_2_1.pdf (260.1Kb)

N/A
N/A
Protected

Academic year: 2022

Share "andre_knutsen_Cons_Gen_Res_2_1.pdf (260.1Kb)"

Copied!
5
0
0

Laster.... (Se fulltekst nå)

Fulltekst

(1)

Brage IMR –

Havforskningsinstituttets institusjonelle arkiv

Brage IMR –

Institutional repository of the Institute of Marine Research

b r ag e im r

Dette er forfatters siste versjon av den fagfellevurderte artikkelen, vanligvis omtalt som postprint. I Brage IMR er denne artikkelen ikke publisert med forlagets layout fordi forlaget ikke tillater dette. Du finner lenke til forlagets versjon i Brage-posten.

Det anbefales at referanser til artikkelen hentes fra forlagets side.

Ved lenking til artikkelen skal det lenkes til post i Brage IMR, ikke direkte til pdf-fil.

This is the author’s last version of the article after peer review and is not the publisher’s version, usually referred to as postprint. You will find a link to the publisher’s version in Brage IMR. It is recommended that you obtain the references from the publisher’s site.

Linking to the article should be to the Brage-record, not directly to the pdf-file.

ttestad

(2)

UNCORRECT

ED

PROOF

T E C H N I C A L N O T E 1

2

Development of twelve novel microsatellite loci in the European

3

lobster (Homarus gammarus)

4 Carl Andre´ Halvor Knutsen

5 Received: 16 November 2009 / Accepted: 17 November 2009 6 ÓSpringer Science+Business Media B.V. 2009

7 Abstract We developed twelve novel microsatellite loci 8 primers in the European lobster (Homarus gammarus). All 9 markers were obtained from partial genomic DNA libraries 10 enriched for tetranucleotide repeats and characterized in 48 11 unrelated individuals from one putative population. The 12 number of alleles ranged from 5 to 13, with an average of 13 8.3 per locus, and the observed heterozygosity ranged from 14 0.35 to 0.83 (average 0.69). These microsatellite loci can 15 be used as markers in the assessment of connectivity and 16 genetic structure of exploited lobster populations.

17

18 Keywords Homarus gammarusMicrosatellite primers 19 PolymorphismPopulation structure

20 European lobster (Homarus gammarus) is a large decapod 21 species of high importance in commercial and recreational 22 fisheries from northern Norway to the Mediterranean Sea.

23 Since the 1950s, European lobster has been in severe 24 decline and is currently on historical low levels in Norway 25 (Pettersen et al. 2009). While the general biology of 26 European lobster is relatively well known, information 27 about population structure relevant for management is 28 scarce. Tagging studies indicate that adult lobsters are 29 relatively stationary, although they may undertake migra- 30 tions of several tens of km’s (Smith et al.2001). European 31 lobster has a free-swimming larval stage that is planktonic

for several weeks, and thus possesses a potential for long- 32 range dispersal. However, little is known about the realized 33 dispersal in natural lobster populations. Earlier genetic 34 studies using allozymes, mtDNA and microsatellites indi- 35 cate large-scale structure along the European coast (Jørstad 36 and Farestveit 1999; Jørstad et al. 2004; Triantafyllidis 37 et al. 2005). Recently, several studies have shown that 38 many marine species are spatially structured into geneti- 39 cally distinct populations on remarkably fine geographic 40 scales (e.g. Jorde et al. 2007). Knowledge about such 41 small-scale population structure and connectivity relevant 42 for the management of European lobster populations is 43 presently lacking. Here, we present 12 microsatellite loci 44 developed for H. gammarus suitable for the detection of 45 potential population structure in this species. 46

We employed the company GIS (Genetic Identification 47 Service Inc.) for the development of tetra repeat microsat- 48 ellite loci. Methods for DNA library construction, enrich- 49 ment and screening were as described previously (Jones 50 et al.2002). Genomic DNA was partially restricted with a 51 cocktail of seven blunt-end cutting enzymes (RsaI,HaeIII, 52 Bsr B1,PvuII,StuI,ScaI, Eco RV). Fragments in the size 53 range of 300–750 bp were adapted and subjected to mag- 54 netic bead capture (CPG, Inc., Lincoln Park, New Jersey), 55 using biotinylated capture molecules. Libraries were pre- 56 pared in parallel using Biotin-AAC(12), Biotin-CAG(10), 57 Biotin-CATC(8) and Biotin-TAGA(8) as capture molecules 58 in a protocol provided by the manufacturer. Captured 59 molecules were amplified and restricted with HindIII to 60 remove the adapters. The resulting fragments were ligated 61 into the HindIII site of pUC19. Recombinant molecules 62 were electroporated intoE. coliDH5a. Recombinant clones 63 were selected at random for sequencing on an ABI 377, 64 using ABI Prism Taq dye terminator cycle sequencing 65 methodology. 66

A1 C. Andre´ (&)

A2 Department of Marine Ecology-Tja¨rno¨, University A3 of Gothenburg, 452-96 Stro¨mstad, Sweden A4 e-mail: [email protected] A5 H. Knutsen

A6 Flødevigen Marine Research Station, Institute of Marine A7 Research, 4817 His, Norway

DOI 10.1007/s12686-009-9151-3

Author Proof

(3)

UNCORRECT

ED

PROOF

Table1PrimersequencesandcharacteristicsoftwelvemicrosatellitelociintheEuropeanlobster(Homarusgammarus) LocusGenBankaccno.Ta(°C)RepeatmotifPrimersequences(50–30)Sizerange(bp)NAHEHOFISP-value HGA8XXXXXXXX56(TATG)23(TTTG)4 (TATG)5F:TTGAACAGCAAAAACGTAGTG269–325120.8280.7440.1020.479 R:ACATCACACCACAACTCACTG HGB4XXXXXXXX56(AAAC)6F:TTCGCTAGTCCGTCTGTCC187–23160.6760.5740.1510.162 R:ACGAAGGATTACGGCACAT HGB6XXXXXXXX56(CCAT)12F:AGAAGGGAGGTGGGTGAG150–19070.7910.791-0.0000.325 R:ATGAACCCGTCTGAGGTTATC HGC6XXXXXXXX56(TGTA)19F:AGGCTGCATAGTTACACGTTTG274–31860.3830.3540.0760.228 R:ACCCAGTGTCAAGGAATAGTCC HGC103XXXXXXXX56(GTAT)10F:TGGTATTATGGCTACGACAAG220–25450.6860.744-0.0850.835 R:CAAAAGACGGGTTTCAATC HGC111XXXXXXXX56(TAGA)8F:TGAAGCGTGGAGGACCTT258–280100.8280.7870.0500.077 R:CACACCTGTCTGGCTACACC HGC118XXXXXXXX56(TACA)10F:TCGTTTCCAATGGTCTCG262–29670.5820.659-0.1330.457 R:AAGTTGAAGGAGGTGCTTGAC HGC120XXXXXXXX56(GTAT)9F:CCCTCTCTCATCCCTCTTATC251–297130.8760.8330.0500.407 R:ACCCTTATTCATCCATCCTTC HGC129XXXXXXXX56(GTAT)7F:TTGAACGCTATGAACTGAGAC247–29160.6100.645-0.0580.911 R:AGGCATACAAATAAACGCAC HGC131bXXXXXXXX56(GTAT)21F:CATGGGTGATTAGGATGACC226–276120.8430.8080.0420.214 R:TGGCACCATAGGTTCGTATC HGD106XXXXXXXX56(CTAT)9F:CATACCGAACCAAGTGTAAAC139–16770.6850.760-0.1110.239 R:GCCCACAGTAACAGATAAGAG HGD111XXXXXXXX56(GATA)8F:TAAAGGTGATGTTCAGTCCAC231–27580.6190.5860.0530.571 R:CTTGACCCGCTACCAATAC Sizerangeoffragments(bp),numberofalleles(NA),expected(HE)andobserved(HO)heterozygosityanddeviationfromHardy–Weinbergexpectations(FIS),arebasedonasampleof48 individuals.UncorrectedP-valuesfortwo-sidedtests

Conservation Genet Resour

Author Proof

(4)

UNCORRECT

ED

PROOF

67 The optimal amplification reaction mix for all primer 68 pairs consisted of 19 BiolaseÓ Buffer, 2 mM MgCl2, 69 0.2 mM each dNTP, 6 M each primer (forward primer 70 fluorescent-labelled), 0.025 U ll-1 BiolaseÓ Taq poly- 71 merase, and 0.2 ngll-1 template DNA in 50ll final 72 reaction volume. Samples were amplified in a Perkin- 73 Elmer-Cetus thermal cycler by an initial three min of 74 denaturation at 94°C, followed by 35 cycles of denaturation 75 (94°C, 40 s), annealing (55°C, 40 s), and extension (72°C, 76 30 s), with final extension of 4 min at 72°C.

77 DNA from eight individuals collected in the Skagerrak 78 Sea was extracted using the PureGene DNA Extraction 79 KitÒ kit (Gentra Systems, Minneapolis, MN, USA) fol- 80 lowing the manufacturers instructions. Microsatellite loci 81 were amplified in 10ll reactions in the following reaction 82 mix: MgCl2, 2 mM; dNTPs (premixed), 0.2 mM each;

83 primers, 0.3lM each; BioTaq DNA PolymeraseÒ(Bioline 84 USA, Canton, MA, USA), 0.025 U ll-1; template DNA, 85 0.2 ngll-1. PCR was conducted in a RoboCycler Gradient 86 96Òthermocycler (Stratagene, Inc., La Jolla, CA, USA) by 87 an initial denaturation (94°C, 3 min), followed by 35 88 cycles of denaturation (94°C, 40 s), annealing (55°C, 40 s), 89 and extension (72°C, 30 s), and a final extension at 72°C 90 for 4 min. PCR products were labelled using one of the 91 conventional sequencing dyes NED, HEX or FAM 92 (Applied Biosystems, Inc.). Amplification products were 93 separated on polyacrylamide gels in an ABA 377 DNA 94 sequencer and sized using Genotyper 2.5 software and Rox 95 400 HD size markers (Applied Biosystems, Inc., Foster 96 City, CA USA). Four libraries were screened for the 97 microsatellite motifs (AAAC)n, (CATC)n (TACA)n and 98 (TAGA)n. A total of 100 clones were sequenced and 19 99 primer pairs designed using DesignerPCR, version 1.03 100 (Research Genetics, Inc.). These 19 primers were tested 101 against 16 additional Skagerrak individuals resulting in 102 twelve polymorphic and reliably amplifying loci.

103 Population screening of the twelve loci was conducted by 104 analysing 48 individuals collected at Ka˚vra, Lysekil on the 105 west coast of Sweden (58.33°N; 11.36°E). Genomic DNA 106 was isolated using Viogene Blood and Tissue Genomic 107 DNA Extraction Miniprep System (Viogene Inc.) according 108 to manufacturer’s protocol. PCR amplifications were carried 109 out in 10ll reaction volumes on Bio-Rad MYCycler, with 110 fluorescently (CY-5) 50-tagged forward primers (Sigma).

111 The standard reaction composition included 1ll of template 112 DNA, corresponding to 20–40 ng, 10915 mM MgCl2

113 PCR buffer, 0.4 mM dNTPs, 0.125 mM of forward and 114 reverse primer (Sigma) and 0.06 units ll-1 of Taq DNA 115 polymerase (Qiagen. Inc.). Dilutions were done using 116 Eppendorf Molecular Biology Grade Water. Thermal 117 cycling conditions were as follows: An initial denaturation 118 step at 94°C for 5 min, followed by 30 cycles of 95°C 119 denaturation, annealing at 56°C (for all loci, see Table1)

and 72°C synthesis, each for 30 s. A final elongation step at 120 72°C for 15 min completed the amplification. 121

Allele sizes and genotypes were determined by fragment 122 analysis using Beckman Coulter CEQ 8000 automated 123 sequencer and included software (CEQ8000 Genetic 124 Analysis System, version 8.0). We tested the loci for all 125 individuals to assess gene diversity and evidence for link- 126 age disequilibrium or deviation from Hardy–Weinberg 127 expectations. Gene diversity and FIS was estimated with 128 GDA (Lewis and Zaykin 2001); significance of FIS was 129 assessed using the probability tests within GENEPOP 130 on the web (http://wbiomed.curtin.edu.au/genepop/). The 131 software MICROCHECKER (Van Oosterhout et al.2004) 132 was used to investigate the potential presence of null alleles 133 or other technical artefacts. No locus deviated significantly 134 from Hardy–Weinberg equilibrium (Table1), or showed 135 evidence of technical artefacts or null-alleles. Three out of 136 67 (4.4%) comparisons between pairs of loci displayed 137 significant linkage disequilibrium (tested in GENEPOP), as 138 expected from chance alone. 139

Acknowledgments This work was supported by the Norwegian 140 government and EU through theINTERREG III Aprogramme (http:// 141 www.imr.no/grensehummer/nb-no). We thank the Swedish Board of 142 Fisheries for lobster samples, and Hanne Sannæs, Anna-Karin Ring 143 and Kate Enersen for technical assistance in the lab. We also thank 144 Mark Todd, Ken Jones, Greg Sadowski and Fred Fernando at GIS for 145 valuable assistance for developing primers and for supervision of the 146 text. 147

References 148

Jones KC, Levine KF, Banks JD (2002) Characterization of 11 149 polymorphic tetranucleotide microsatellites for forensic applica- 150 tions in California elk (Cervus elaphus canadensis). Mol Ecol 151 Notes 2:425–427 152

Jorde PE, Knutsen H, Espeland SH, Stenseth NC (2007) Spatial scale 153 of genetic structuring in coastal cod Gadus morhua and the 154 geographic extent of local populations. Mar Ecol Prog Ser 155 343:229–237 156

Jørstad KE, Farestveit E (1999) Population genetic structure of lobster 157 (Homarus gammarus) in Norway, and implications for enhance- 158 ment and sea-ranching operation. Aquaculture 173:447–457 159 Jørstad KE, Prodo¨hl PA, Agnalta A-L, Hughes M, Apostolidis AP, 160

Triantafyllidis A, Farestveita E, Kristiansen TS, Mercerd J, 161 Sva˚sand T (2004) Sub-arctic populations of European lobster, 162 Homarus gammarus, in northern Norway. Environ Biol Fish 163 69:223–231 164

Lewis PO, Zaykin D (2001) Genetic data analysis: computer program 165 for the analysis of allelic data (version 1.0, d16c)http://lewis. 166 eeb.uconn.edu/lewishome/software.html 167

Pettersen AR, Moland E, Olsen EM, Knutsen JA (2009) Lobster 168 reserves in coastal Skagerrak—an integrated analysis of the 169 implementation process. In: Dahl E, Moksness E, Støttrup J (eds) 170 Integrated coastal zone management. Wiley, London, pp 178– 171 188 172

Smith IP, Jensen AC, Collins KJ, Mattey EL (2001) Movement of 173 wild European lobstersHomarus gammarusin natural habitat. 174 Mar Ecol Prog Ser 222:177–186 175

Author Proof

(5)

UNCORRECT

ED

PROOF

176 Triantafyllidis A, Apostolidis AP, Katsares V, Kelly E, Mercer J, 177 Hughes M, Jørstad KE, Tsolou A, Hynes R, Triantaphyllidis C 178 (2005) Mitochondrial DNA variation in the European lobster 179 (Homarus gammarus) throughout the range. Marine Biol

180 146:223–235

Van Oosterhout C, Hutchinson WF, Wills DP, Shipley P (2004) 181 Microchecker: software for identifying and correcting genotyp- 182 ing errors in microsatellite data. Mol Ecol Notes 4:535–538 183

184 Conservation Genet Resour

Author Proof

Referanser

RELATERTE DOKUMENTER

2 Centre for Ecological and Evolutionary Synthesis (CEES), University of Oslo, PO Box 1066, Blindern, 0316 Oslo, Norway. 3 Bodø University College, Department of Fisheries and

Fanafjorden (11) at Hordaland had multiple deep sills and the shallowest one was noted. In agreement with the raw data, all examined model formulations indicate a clear effect

The thesis is about how the implementation of the new management structure and leadership philosophy is communicated throughout the organization and how it is received at the local

Adult specimens of Arion slugs were collected into plastic boxes in 2014 from 42 populations across eight European countries: Norway (13), Poland (12), France (4), Denmark (3),

In contrast, experts (27/42) agreed on using reactive interventions (i.e., the active management of admixed individuals) only for small and recovering wolf populations.. The use

The aim of this study is to evaluate brown trout genetic diversity and population structure, while considering also the effects on freshwater pearl mussel

Adult specimens of Arion slugs were collected into plastic boxes in 2014 from 42 populations across eight European countries: Norway (13), Poland (12), France (4), Denmark

However, a shift in research and policy focus on the European Arctic from state security to human and regional security, as well as an increased attention towards non-military