1 Inflammatory bowel disease associated GP2 autoantibodies inhibit mucosal 1
immune response to adherent-invasive bacteria 2
3
Stefanie Derer, PhD1,#, Ann-Kathrin Brethack1,#, Carlotta Pietsch1, Sebastian T.
4
Jendrek, MD2, Thomas Nitzsche, PhD1,3, Arne Bokemeyer, MD4, Johannes R. Hov, 5
MD5, 6, Holger Schäffler, MD7, Dominik Bettenworth, MD4, Guntram A. Grassl, PhD8, 6
Christian Sina, MD1,9* 7
1 Institute of Nutritional Medicine, Molecular Gastroenterology, University Hospital Schleswig- 8
Holstein, Campus Lübeck, Lübeck, Germany.
9
2 Department of Rheumatology, University of Schleswig-Holstein, Lübeck, Germany.
10
3 Institute for Experimental Immunology, Euroimmun Corp., Lübeck, Germany.
11
4 Department of Medicine B, Gastroenterology and Hepatology, University of Münster, 12
Münster, Germany.
13
5 Institute of Clinical Medicine, University of Oslo, Oslo, Norway.
14
6 Norwegian PSC Research Center, Section of Gastroenterology and Research Institute of 15
Internal Medicine, Division of Surgery, Inflammatory diseases and Transplantation, Oslo 16
University Hospital, Oslo, Norway.
17
7 Department of Medicine II, Division of Gastroenterology, Rostock University Medical Center, 18
Rostock, Germany.
19
8 Institute of Medical Microbiology and Hospital Epidemiology and German Center for 20
Infection Research (DZIF), Partner Site Hannover-Braunschweig, Hannover Medical School, 21
Hannover, Germany.
22
9 1st Department of Medicine, Section of Nutritional Medicine, University Hospital Schleswig- 23 Holstein, Campus Lübeck, Lübeck, Germany
24 25
# these authors contributed equally to this project 26
27
Running title: GP2 AAbs block mucosal immunity in IBD 28 29
Short summary: Elevated GP2-directed autoantibody level are induced by 30
excessive intestinal GP2#4 expression triggered by TNFa and FimH in IBD patients.
31
IBD-associated anti-GP2 autoantibodies inhibit detection of adherent-invasive 32
bacteria via M- and L-cell expressed GP2#4, resulting in impaired mucosal immune 33
responses.
34 35 36
4,857 words 37
38
2
* Corresponding author:
1
Christian Sina, MD 2
Institute of Nutritional Medicine 3
University Hospital Schleswig-Holstein, Campus Lübeck 4
Ratzeburger Allee 160 5
D-23538 Lübeck, Germany 6
Tel: 49(0)451/3101 8400 7
Fax: 49(0)451/3101 8404 8
3 Abstract
1
Adherent-invasive E. coli have been suggested to play a pivotal role within the 2
pathophysiology of inflammatory bowel disease (IBD). Autoantibodies against distinct 3
splicing variants of glycoprotein 2 (GP2), an intestinal receptor of the bacterial 4
adhesin FimH, frequently occur in IBD patients. Hence, we aimed to functionally cha- 5
racterize GP2-directed autoantibodies as a putative part of IBD’s pathophysiology.
6
Ex vivo, GP2 splicing variant 4 (GP2#4) but not variant 2 was expressed on intestinal 7
M- or L-cells with elevated expression patterns in IBD patients. GP2#4 expression 8
was induced in vitro by TNFa. IBD-associated GP2 autoantibodies inhibited FimH 9
binding to GP2#4 and were decreased in anti-TNFa treated Crohn’s disease patients 10
with ileocolonic disease manifestation. In vivo, mice immunized against GP2 prior to 11
infection with adherent-invasive bacteria displayed exacerbated intestinal 12
inflammation. In summary, autoimmunity against intestinal expressed GP2#4 results 13
in enhanced attachment of flagellated bacteria to the intestinal epithelium and 14
thereby may drive IBD’s pathophysiology.
15 16
149 words 17
Key words: FimH; Crohn's disease; ulcerative colitis; M cells; L cells; anti-GP2 18
autoantibodies 19
4 1 Introduction
1 2
Glycoprotein 2 (GP2) is the major zymogen granule membrane protein of pancreatic 3
acinar cells and belongs to the zona pellucida (ZP) domain containing protein family 4
[1]. While no functional role of GP2 could be identified in the pancreas, yet [2], it is 5
thought that pancreatic secreted GP2 exerts pivotal anti-bacterial activity in the 6
gastrointestinal (GI) tract. Intestinal GP2 is supposed to bind to FimH positive 7
bacteria [3] similar to its structural homolog Uromodulin/Tamm-Horsfall protein (THP), 8
which is essential for the elimination of flagellated bacteria from the urogenital tract 9
[3, 4].
10
FimH is a protein consisting of the mannose-binding lectin domain at the N-terminus 11
and the pillin domain at the C-terminus that is expressed by adherent-invasive gram- 12
negative bacteria such as Escherichia coli (E. coli) and Salmonella Typhimurium 13
(STM). Of note, inflammatory bowel disease (IBD) patients display increased 14
numbers of intestinal adherent-invasive E. coli [5].
15
Moreover, GP2 has been identified as a binding receptor for FimH expressing 16
bacteria on the apical cell membrane of intestinal microfold (M) cells [6, 7]. M cells 17
are specialized intestinal epithelial cells (IECs) expressed exclusively at the terminal 18
ileum overlying the mucosa-associated lymphoid tissue of intestinal Peyer's patches.
19
Their function is the transcellular transport of luminal antigens to the basolateral 20
membrane in order to allow the contact with antigen presenting cells and thus to 21
trigger innate and adaptive immune responses [6]. Therefore, M cells are supposed 22
to constitute the main site being critical in the development of Crohn’s disease [8].
23
It is known that two isoforms of GP2, alpha and beta, are generated by alternative 24
splicing events. The larger isoform GP2a, also designated GP2 variant 2 (GP2#2), 25
encompasses 527 amino acids (aa) including a signal sequence, a unique 194 aa 26
long domain representing five N-glycosylation sites, an EGF-like domain for protein- 27
protein interactions, a ZP domain that also comprises three N-glycosylation sites and 28
a transmembrane domain that is removed when a glycosylphosphatidylinositol (GPI) 29
anchor is attached to the protein (Fig. 1). The smaller isoform GP2b, also designated 30
GP2 variant 4 (GP2 #4), N-terminally lacks 147 aa of the unique domain and hence 31
three putative N-linked glycosylation sites. Furthermore, GP2#4 mRNA and protein 32
expression seem to be the predominant isoform in pancreatic tissues [9].
33
5 In 2009, GP2 was identified as an antigen for pancreatic autoantibodies (PAbs) that 1
occur approximately in one third of all Crohn's disease (CD) patients [10]. Notably, a 2
recent study reported decreased GP2 protein level in fecal samples collected from 3
CD patients in comparison to healthy individuals [11].
4
The existence of PAbs was described for Crohn's disease in 1984 [12]. Since then, 5
the diagnostic significance of these autoantibodies with respect to the diagnosis of 6
IBD and the delimitation to ulcerative colitis (UC) has been evaluated in several 7
studies. Overall, approximately 30% of patients with CD exhibit pancreatic 8
autoantibodies while patients with UC as well as healthy volunteers are serologically 9
inconspicuous [13, 14, 15]. Furthermore, a recent study from our group demonstrated 10
IgG and/or IgA PAbs directed against GP2 in CD patients to be positively associated 11
with a stricturing disease phenotype, immunosuppressants intake and disease 12
duration but to be negatively associated with colonic disease [16]. In the same study, 13
a minority of UC patients displayed anti-GP2-IgA PAbs. Interestingly, these patients 14
suffered from primary sclerosing cholangitis (PSC) as an extraintestinal 15
manifestation. Based on these findings, we investigated sera samples collected from 16
two independent PSC patient cohorts with regard to anti-GP2 PAbs titres. Notably, 17
anti-GP2 IgA autoantibodies were associated with poor survival and the development 18
of cholangiocarcinoma in patients with PSC [17]. Of note, these studies did not focus 19
on the identification of autoantibodies directed against distinct GP2 splicing variants.
20
Together, the functionality of GP2 directed autoantibodies in the gastrointestinal tract 21
remains elusive. In the present study, we studied the expression of GP2 splicing 22
variants in different human intestinal compartments as well as the presence and 23
function of autoantibodies directed against these variants in IBD patients.
24
Furthermore, we established an STM infection mouse model to unravel the role of 25
GP2-directed autontibodies for intestinal host-microbe interaction as a 26
pathophysiological hallmark in IBD.
27
6 2 Material & Methods
1
2.1 Study population 2
The study population of the present study included 142 individuals. Of those, 37 and 3
76 patients suffered from histologically confirmed UC and CD, respectively. In 4
addition, 20 hospitalized patients without macroscopic and histological evidence of 5
mucosal inflammation as well as 9 healthy individuals (only whole blood samples) 6
were included. Patients’ characteristics are depicted in table 1. Ileal and colonic 7
biopsies as well as the collection of plasma/serum or fecal samples were obtained 8
during or before colonoscopy, respectively, at the University Hospital Schleswig- 9
Holstein, Campus Lübeck, the University Hospital Münster or the University Hospital 10
Rostock. In addition, a subset of serum samples from the Inflammatory Bowel 11
Disease of South-Eastern Norway were included [18]. The evaluation of acute flare of 12
disease was based upon clinical data and endoscopic and histological findings. In 13
detail, the presence of active disease was considered either due to macroscopically 14
and/ or microscopically signs of intestinal inflammation. In case that no endoscopy 15
was available, active disease was defined based on the combination of clinical signs 16
of acute flare including diarrhea, rectal and abdominal pain as well as biological 17
markers of disease including elevated CRP and elevated fecal calprotectin levels.
18
The endoscopies were part of regular patient management. All patients agreed to 19
participation by giving informed consent at least 24 h before the procedure and the 20
study was granted prior approval by the local ethics committees.
21
Patients or the public were not involved in our work.
22 23
2.2 Ethics statement 24
Ethical Committees of the University of Lübeck (AZ 13/084A; AZ 05-112), of the 25
University of Münster (AZ 2016-305-b-S), of the University of Rostock (A 2017- 26
0137) as well as the Regional Committee for Medical and Health Research Ethics 27
South-Eastern Norway B [18].
28
Animal experiments were conducted in direct accordance with the German Animal 29
Protection Law consistent with the ethical requirements and approval of the Animal 30
Care Committee of the Ministry of Energy, Agriculture, the Environment and Rural 31
Areas of Schleswig-Holstein, Germany (protocol # V244-7224.121.3 (87-7/11)).
32 33
7 2.3 Infection of mice
1
Male wild-type C57BL/6J mice were immunized three times (day 0, day 4 and day 7) 2
with 50 µg recombinant human GP2 protein by intraperitoneal injection. On day 13 3
mice were treated with streptomycin (20 mg/mouse) by oral gavage. On day 14, mice 4
were infected with 3x106 Salmonella enterica serovar Typhimurium SL1344 (STM) in 5
100 µl HEPES buffer by oral gavage. Controls were gavaged with HEPES buffer 6
only. At indicated times, mice were sacrificed, intestinal and systemic tissues were 7
removed and homogenized. Serially dilutions were plated on LB agar containing 8
streptomycin (100 μg/ml) to quantify bacterial load.
9 10
2.4 Cell Lines 11
The human colorectal carcinoma cell lines DiFi [19], HT-29 (DSMZ, Braunschweig, 12
Germany), Colo320 (DSMZ) or Caco-2 (DSMZ) were kept in Dulbecco modified 13
Eagle medium supplemented with 10% (v/v) heat-inactivated fetal calf serum, 100 14
U/ml penicillin, and 100 μg/ml streptomycin.
15
For stimulation experiments with DiFi cells, human TNFa (Thermo Fisher Scientific, 16
Waltham, MA, USA), lipopolysaccharide (LPS; Invivogen, San Diego, California, 17
USA) or E. coli-derived FimH protein (LifeSpan BioSciences, Seattle, Washington, 18
USA) were used at indicated concentrations.
19 20
2.5 RNA extraction and real-time quantitative PCR 21
RNA was extracted using the innuPREP RNA mini kit (Analytik Jena AG, Jena, Ger- 22
many) and transcribed to cDNA (RevertAid H Minus reverse transcriptase, Thermo 23
Scientific, Schwerte, Germany) using the T Gradient thermocycler (Whatman Biome- 24
tra, Göttingen, Germany). Real-time quantitative PCR (qPCR) was carried out using 25
MaximaR SYBR Green qPCR Master Mix, plus specific oligonucleotides using a 96- 26
well plate format. The amplification program consisted of: (i) preincubation at 95 °C 27
for 5 min; (ii) 40 cycles of denaturation at 95 °C for 45 sec and annealing at appro- 28
priate temperature (55 °C) for 1 min using the StepOne Plus Real-Time PCR System 29
(ThermoFisher Scientific). Melting curve profiles were produced and analyzed follo- 30
wing the dCt algorithm. Expression levels were normalized to b-Actin. The following 31
oligonucleotides were used for analyses (human b-actin: for: 5`- 32
ACATCCGCAAAGACCTGTACG -3`, rev: 5`- TTGCTGATCCACATCTGCTGG -3`;
33
8 human GP2#2: for: 5’- GAGATACTGCACAGACCCAT -3’; human GP2#4: for: 5’- 1
GCAGCGAGACCCATCCAC -3’; human GP2 rev: 5`-
2
TGGGTAGGCACATTGGAAGT -3; murine GP2#2: for: 5’-
3
CAGCTCCAATCTGGACTTGG -3’; murine GP2#4: for: 5’-
4
CATCAAGACCCCTCCACTG -3’; murine GP2 rev: 5`- CACCCAGTTGTTGGGCTCA 5
-3; murine b-actin: for: 5`- GATGCTCCCCGGGCTGTATT -3`, rev: 5`- 6
GGGGTACTTCAGGGTCAGGA -3`.
7 8
2.6 Immunohistochemistry 9
Immunohistochemical techniques were performed according to standard protocols, 10
and histologic scores were determined [20]. Briefly, deparaffinized tissue sections 11
were fixed and stained with hematoxylin-eosin (HE), an anti-GP2#2 antibody 12
(HPA016668; Sigma-Aldrich, St. Louis, MO), an anti-GP2#2 and #4 antibody 13
(HPA015739; Sigma-Aldrich) or with respective rabbit isotype control antibody, 14
washed and incubated with HRP-conjugated anti rabbit IgG secondary Ab.
15
Afterwards, tissue slides were incubated with DAB substrate (Dako, Hamburg, 16
Germany) and counterstained with Mayer`s hemalum solution.
17
For fluorescence microscopy, deparaffinized tissue sections were fixed and co- 18
stained with primary antibodies specific for human GP2#4 (HPA015739; Sigma- 19
Aldrich) and human peptide YY (PYY; sc-47318; Santa Cruz Biotechnology, Inc, 20
Dallas, Texas, USA). After washing, tissue sections were first incubated with an 21
Alexa-Fluor488-conjugated donkey anti-goat IgG secondary antibody (A11055;
22
Thermo Fisher Scientific). After further washing and blocking steps with a 23
AlexaFluor594-conjugated goat anti-rabbit IgG secondary antibody (A11012; Thermo 24
Fisher Scientific), tissue slides were counterstained using the fluorescent stain 4′,6- 25
diamidino-2-phenylindole (DAPI). Tissue slides were finally analyzed using an Axio 26
Scope A.1 microscope (Zeiss, Oberkochen, Germany).
27 28
SDS-PAGE and immunoblotting 29
Whole-protein extracts were prepared by lysing biopsy samples or cell pellets in de- 30
naturing lysis buffer containing 1% SDS, 10 mM Tris (pH 7.4), and 1% protease 31
inhibitor mixture (Complete Protease Inhibitor Cocktail; Roche Applied Science, 32
Mannheim, Germany). Forty micrograms of protein extracts were separated by 33
denaturing SDS-PAGE under reducing or non-reducing conditions and transferred 34
9 onto polyvinylidene difluoride membranes. After blocking, membranes were probed 1
with human GP2-specific primary Abs (HPA016668 or HPA015739; Sigma-Aldrich) or 2
a mouse GP2-specific primary Ab (ABIN2118673; antibodies-online GmbH, Aachen, 3
Germany), washed, and incubated with HRP-conjugated IgG as secondary Ab. In the 4
case of semi-quantitative analyses of the presence of a-D-mannose/ a-D-glucose 5
residues, 100 nanogram of recombinant human GP2#2 or GP2#4 were separated by 6
denaturing SDS-PAGE under reducing conditions and transferred onto nitrocellulose 7
membranes. After blocking, membranes were probed with HRP-conjugated 8
concanavalin A as described in the manufacturer’s instructions (Sigma-Aldrich). Pro- 9
teins or glycosylation structures were visualized by chemiluminescence. To 10
determine similar transfer and equal loading, membranes were stripped and reprobed 11
with an Ab specific for b-actin (Sigma-Aldrich) or with an Ab specific for a-Tubulin 12
(#2125, Cell Signaling Technology, Frankfurt am Main, Germany) as well as with an 13
Ab specific for human GP2#2 and #4..
14 15
2.7 Anti-GP2-Ig specific ELISA 16
Human peripheral blood was collected using an S-Monovette® containing either the 17
anti-coagulant Hirudin (Sarstedt, Nümbrecht, Germany; german cohort) or no 18
additives (Sarstedt; Norway cohort). From the german cohort, plasma samples were 19
prepared by placing the whole blood samples on ice for 30 minutes before 20
centrifugation. Whole blood samples from the Norway cohort as well as murine 21
whole blood samples were collected, incubated for 60 minutes at room temperature 22
and centrifuged to obtain serum samples.
23
To detect immunoglobulin A or immunoglobulin G autoantibodies directed against 24
human GP2#2 or human GP2#4 in serum/plasma samples collected from patients 25
with inflammatory bowel disease or from healthy individuals sandwich ELISA 26
experiments were performed. Microtiter plates were coated either with human 27
recombinant GP2 variant 2 (rhGP2#2; LifeSpan BioSciences, Seattle, Washington, 28
USA) or with rhGP2#4 (OriGene; Rockville, Maryland, USA) diluted in dulbecco`s 29
phosphate buffered saline (dPBS; end concentration 1 µg/ml) over night at 4°C. After 30
blocking of plates, diluted serum samples (5 % v/v) were added in duplicates and 31
incubated for 2 hours at room temperature, washed and incubated either with HRP- 32
conjugated anti-human IgA or anti-human IgG secondary antibodies. After another 33
washing step, the substrate 3,3’,5,5’-Tetramethylbenzidine (TMB) was added and 34
10 reaction was stopped using hydrochloric acid (HCl). Optical density (OD) was 1
measured at the absorbance of 450 nm and reference wave length of 540 nm using a 2
microplate reader (SpectraMax® iD3; Molecular Devices, San Jose, CA, USA).
3 4
2.8 FimH protein binding to GP2 variants 5
A sandwich ELISA was performed to study the binding capacity of FimH protein to 6
GP2 splicing variants in the presence or absence of IBD plasma/serum samples or 7
plasma samples collected from healthy individuals. Microtiter plates were coated 8
either with rhGP2#2 protein or with rhGP2#4 protein (end concentration 1µg/ml) over 9
night at 4°C. After a blocking step, plates were pre-incubated with 1% v/v of 10
plasma/serum samples for 30 min at room temperature. After 30 minutes, FimH 11
protein was added to the plates at increasing concentrations (0 µg/ml; 0.08 µg/ml; 0.4 12
µg/ml; 2 µg/ml; 10 µg/ml and 50 µg/ml) and plates were further incubated for two 13
hours at room temperature. After washing, a mouse anti-FimH antibody (X-P08191;
14
Abmart, Berkeley Heights, NJ, USA) was added for one hour at room temperature, 15
plates were washed and incubated with a HRP-conjugated anti-mouse IgG antibody 16
(Cell Signaling Technology Inc.). Finally, the TMB substrate was added and the 17
reaction was stopped using an HCl solution. Optical density (OD) was measured at 18
the absorbance of 450 nm with a reference wavelength of 540 nm using microplate 19
reader (SpectraMax® iD3; Molecular Devices).
20 21
2.9 Statistical analysis 22
Data are displayed graphically and were statistically analyzed using GraphPad Prism 23
6.0. Values of p ≤ 0.05 were considered statistically significant. If not stated 24
otherwise, experiments and measurements were replicated at least three times.
25 26
11 3 Results
1
3.1 Plasma level and binding epitopes of GP2-directed autoantibodies differ 2
between healthy individuals and IBD patients. The early studies of anti-GP2 anti- 3
bodies analyzed autoantibody formation against GP2 variant 2 in CD patients [10, 13, 4
16], while studies of autoantibodies against GP2 variant 4 in IBD patients have arisen 5
more recently [21, 22, 23]. Hence, we systematically studied the presence of anti- 6
GP2-directed autoantibodies of IgG or IgA isotypes in plasma samples collected from 7
adult healthy individuals or IBD patients (german cohort) by ELISA with regard to dif- 8
ferences between GP2#2- or GP2#4-directed autoantibodies (Fig. 1). As demonstra- 9
ted in figure 1a, healthy individuals and UC patients displayed plasma IgG-autoanti- 10
bodies against GP2 variant 2 but not against GP2 variant 4. In contrast, we detected 11
GP2-directed IgG-autoantibodies in plasma samples from CD patients with similar 12
capacities to bind to both variants of GP2 (Fig. 1a). These results were strengthened 13
by the finding that anti-GP2#2-IgG level significantly correlated with anti-GP2#4-IgG 14
level in CD patients but not in healthy individuals or UC patients (Fig. 1b). IgA-auto- 15
antibodies against both GP2 variants were detected in healthy individuals as well as 16
in IBD patients. However, significantly higher GP2-directed IgA-autoantibody plasma 17
level were determined in CD and UC patients in comparison to healthy individuals 18
(Fig. 1c). Furthermore, anti-GP2#2-IgA level significantly correlated with anti-GP2#4- 19
IgA level in plasma samples from IBD patients or healthy individuals (Fig. 1d).
20
By analyzing the predicted protein structure of GP2 we suggested plasma IgG auto- 21
antibodies from healthy individuals to bind to epitopes located within the “unique” do- 22
main of GP2#2 (Fig. 1g+h). In contrast, CD patients displayed increased IgG- and 23
IgA-autoantibody level while UC patients displayed only increased IgA-autoantibody 24
level directed against epitopes present in GP2 variants 2 and 4, pointing to binding of 25
these autoantibodies to the last 39 amino acid residues of the “unique” domain as 26
well as to the zona pellucida (ZP) domain of GP2 (Fig. 1g-i). Previously, silencing of 27
either all or single N-glycan sequons in human GP2#2 was accompanied by a 28
complete loss of binding of anti-GP2 autoantibodies from IBD patients [13]. These 29
data revealed the N-glycosylation residues to be crucial for binding of IBD-related 30
anti-GP2 autoantibodies. However, as one cannot exclude changes of protein 31
conformation due to silencing of N-glycan sequons in GP2, it is not clear until now 32
whether glycosylation or protein conformation is crucial for reduced autoantibody 33
binding.
34
12 We next investigated whether different types of autoantibodies are present in IBD 1
plasma/sera that either bind to common epitopes of both GP2 variants or to GP2 vari- 2
ant specific epitopes. Here, we analyzed IgG level in CD plasma/sera as well as IgA 3
level in CD and UC plasma/sera against both GP2 variants before and after pre-ab- 4
sorption of the respective plasma/sera either to GP2#2 or to GP2#4 by ELISA. As de- 5
picted in figure 1e, anti-GP2#2-IgG level were significantly reduced after pre-absorp- 6
tion of CD plasma/sera to GP2#2, whereas levels were not significantly altered upon 7
pre-absorption to GP2#4. Interestingly, anti-GP2#4-IgG level in CD were significantly 8
diminished after pre-absorption of the plasma/sera either to GP2#2 or GP2#4 (Fig.
9
1e). Furthermore, in the case of GP2-directed IgA-autoantibodies in CD and UC, we 10
detected diminished level of both, anti-GP2#2-IgA and anti-GP2#4-IgA, autoantibo- 11
dies irrespectively of pre-absorption to GP2#2 or GP2#4 (Fig. 1f).
12
Together, these data point to the presence of IgA-autoantibodies in CD and UC that 13
bind to common epitopes of both GP2 variants. Additionally, in CD two distinct IgG- 14
autoantibodies are also present, one that binds to GP2#2-specific epitopes located 15
within the “unique” domain and one that binds to common epitopes of GP2#2 and 16
GP2#4. Hence, it may be concluded that IgG- and IgA-autoantibodies that bind to 17
common epitopes of both GP2 variants are more prominent in comparison to GP2#2- 18
specific IgG-autoantibodies in IBD patients.
19 20
3.2 IBD patients display GP2-directed autoantibodies that inhibit FimH 21
binding to GP2#4. The “unique” domain of GP2#2 comprises many N-glycosylation 22
sites that are suggested to enable proper FimH protein binding to surface exposed 23
mannose residues [6]. As five N-glycosylation sites are still present within shared 24
amino acid sequences of both GP2 variants as well as that the ZP domain of GP2 25
protein is crucial for protein polymerization and hence for the formation of an 26
extracellular matrix preventing binding of FimH positive bacteria to the intestinal 27
epithelium [24], one may hypothesize that GP2-directed autoantibodies in IBD 28
patients mainly prevent FimH binding and GP2 polymerization.
29
In the first step, we performed semi-quantitative analyses of the presence of a-D- 30
mannose residues on utilized rhGP2#2 and rhGP2#4 proteins by utilizing the lectin 31
Concanavalin A in Western blot experiments. As depicted in supplementary figure 1, 32
lower amounts of a-D-mannose residues were detected on rhGP2#4 in comparison 33
13 to rhGP2#2 (Suppl. Fig. 1). Next, we studied FimH protein binding to GP2 variant 2 or 1
4 by ELISA experiments in the absence or presence of plasma/serum samples from 2
healthy individuals or from IBD patients. Of note, FimH protein was found to 3
exclusively bind in a concentration-dependent manner to human GP2#4 but not to 4
human GP2#2 (Fig. 2a). Accordingly, in the presence of plasma samples from 5
healthy individuals no FimH protein binding to GP2#2 was observed, although a 6
concentration-dependent binding was found to GP2#4. Furthermore, FimH protein 7
did not bind to GP2 variant 2 or 4 in the presence of IBD plasma/sera samples (Fig.
8
2b), resulting in a statistically significant decrease of FimH binding to GP2#4 in the 9
presence of CD or UC plasma/sera in comparison to healthy individual plasma 10
samples (Fig. 2c). In general, FimH binding to GP2#4 did not correlate with GP2- 11
directed IgG level (Fig. 2d) but negatively correlated with GP2-directed IgA level in 12
IBD (Fig. 2e).
13 14
3.3 GP2 variant 4 but not 2 is expressed on specific intestinal epithelial cells.
15
To study intestinal mRNA expression of GP2 splicing variants #2 and #4 in different 16
intestinal compartments, ileal and colonic biopsy samples from hospitalized non-IBD 17
(HN) patients were assayed in qPCR experiments. Notably, in comparison to GP2#2 18
significantly higher GP2#4 mRNA expression level were determined in both, ileal and 19
colonic specimen (Fig. 3a). IHC analyses utilizing two distinct monoclonal antibodies 20
targeting either specific epitopes of human GP#2 or common epitopes of human 21
GP2#2 and #4 (Fig. 3b+c) revealed exclusive GP2#4 protein expression in specific 22
intestinal epithelial cells (IECs) in both small intestinal (Fig. 3d) and colonic (Fig. 3e) 23
tissue slides. Furthermore, no GP2#2 protein staining was observed by IHC experi- 24
ments or western blot experiments (data not shown) in any of the tested human intes- 25
tinal tissue samples. GP2 has been previously described to be expressed on small 26
intestinal M cells that normally are not present in the colonic compartment [7, 25].
27
Hence, we aimed to unravel the colonic IEC entity that expresses GP2#4. Due to 28
their shape and count, we hypothesized that GP2#4 may be expressed on enteroen- 29
docrine L-cells that are mainly localized to the colon [26]. Therefore, IHC experiments 30
utilizing colonic biopsy samples were performed to study co-localization of GP2#4 31
and the L-cell expressed peptide YY (PYY). As depicted in figure 3f, co-localization of 32
14 GP2#4 and PYY was indeed detected, pointing to a mere L-cell specific expression 1
of GP2#4 in the colon (Fig. 3f).
2 3
3.4 Intestinal expression of GP2 variant 4 is highly up-regulated in IBD 4
patients. According to this novel finding that the GP2 splicing variant #4 but not #2 is 5
exclusively expressed in the intestine, we investigated intestinal GP2#4 and GP2#2 6
expression level in non-inflamed biopsy samples collected from HN or IBD patients 7
(Fig. 4). First, we identified ileal GP2#4 mRNA (Fig. 4a) and protein (Fig. 4b) 8
expression level to be significantly up-regulated in CD patients when compared to 9
HN. Herein, ileal GP2#2 protein expression could neither be detected in non-inflamed 10
biopsy samples from HN nor from CD patients using a specific monoclonal antibody 11
in western blot experiments (data not shown). Notably, lowest ileal GP2#4 protein ex- 12
pression was observed in CD patients with an ileocolitis. Furthermore, while CD 13
patients with an ileitis displayed high expression of GP2#4 protein with a molecular 14
mass of ~75 kDa, Crohn’s colitis patients displayed high expression of two distinct 15
GP2#4 proteins with molecular masses of ~75 kDa and >250 kDa, probably reflecting 16
monomeric and polymeric GP2#4 proteins (Fig. 4b).
17
In line with results from small intestinal compartments, colonic GP2#4 protein level 18
were also highly up-regulated in non-inflamed biopsy samples from IBD patients in 19
comparison to HN (Fig. 4c), while again colonic GP2#2 protein could not be detected 20
(data not shown). In accordance with these data, IHC analyses of ileal and colonic 21
tissue slides demonstrated an increased occurrence of GP2#4 expressing IECs in 22
IBD patients compared to HN. Interestingly, in CD patients increased numbers of 23
GP2#4 expressing cells were found in the ileum, while in UC patients the number of 24
GP2#4 expressing cells was increased exclusively in the colon (Fig. 4d). In addition, 25
we examined GP2#4 mRNA expression level in paired ileal and colonic biopsy sam- 26
ples from four different IBD patients. Here, we verified lower colonic GP2#4 mRNA 27
expression when compared to paired ileal samples from the same IBD patient, irre- 28
spectively of the inflammation status. Furthermore, GP2#4 mRNA was decreased in 29
inflamed ileal specimen in comparison to paired non-inflamed ileal one in CD patient 30
#4 (Fig. 4e).
31 32
15 3.5 TNFa and FimH regulate GP2#4 expression and anti-TNFa therapy 1
decreases GP2-directed autoantibody level in CD patients. Next, we studied the 2
regulation of GP2 expression in the colorectal carcinoma (CRC) cell line DiFi that 3
was found to endogenously express GP2#2 and GP2#4 mRNA transcripts in contrast 4
to other CRC cell lines (Fig. 4f). However, no GP2#4 or GP2#2 protein expression 5
was detected under basal conditions in DiFi cells by western blot experiments (Fig.
6
4g and data not shown). Notably, stimulation of DiFi cells with distinct bacteria- 7
derived stimulants (LD-MDP, peptidoglycan, LPS, flagellin, FimH) as well as with the 8
most prominent pro-inflammatory cytokine in IBD, TNFa, unraveled FimH protein and 9
TNFa to induce up-regulation of GP2#4 protein expression in DiFi cells, while all 10
other tested stimulants did not show any effect (Fig. 4g and data not shown).
11
These findings were further validated by data demonstrating a significant reduction of 12
GP2-directed IgG-and IgA-autoantibody level in anti-TNFa treated CD patients with 13
an ileocolonic but not colonic disease manifestation (Suppl. Fig. 3a+b).
14
15
3.6 In vivo GP2-directed autoantibodies inhibit the mucosal immune 16
response to adherent-invasive bacteria. Following our results that GP2-directed 17
autoantibodies in IBD patients prevent FimH binding in line with the observation that 18
FimH positive bacteria such as pathophysiological relevant adherent-invasive E. coli 19
are predominantly present in IBD patients [27, 28] we further established a murine 20
STM infection model. Only one GP2 mRNA transcript has been described in mice 21
whose mRNA sequence resembles human GP2 variant 2 with a homology of 75% so 22
far. Based on GP2 sequence alignments we proposed the presence of an additional 23
murine GP2 variant similar to GP2 variant 4 in humans. Hence, we built primer pairs 24
specific for potential murine GP2 variant 2 or 4 based on the human GP2 mRNA 25
sequences. Indeed, mRNA transcripts of both GP2 variants were amplified in whole 26
pancreatic, ileal or colonic cDNA samples from mice with strongest expression level 27
in the pancreas (Fig. 5a). However, murine GP2#4 mRNA was found to be higher 28
expressed in all three tested tissues as observed in human tissues. Results received 29
from qPCR experiments were verified by western blot experiments utilizing a primary 30
antibody that binds to C-terminal epitopes of murine GP2, therefore being able to 31
16 detect both GP2 variants. Here, we found indeed protein expression of two GP2 1
variants in murine pancreatic tissue (Fig. 5b).
2
According to these findings, we immunized mice with recombinant human GP2 pro- 3
tein (GP2#2 and GP2#4; Fig. 5c) by intraperitoneal injection, resulting in the gene- 4
ration of serum IgG-autoantibodies binding to shared epitopes of human GP2#2 5
and human GP2#4 (Fig. 5d-f) as well as to auto reactive murine IgG against murine 6
GP2 expressing pancreatic tissue (Suppl. Fig. 1). Immunized or non-immunized 7
mice were treated with streptomycin on day 13 and infected with the FimH 8
expressing bacterium Salmonella Typhimurium (STM) or treated with control buffer 9
on day 14 (Fig. 5d). One day post infection, mice being previously immunized 10
against GP2 demonstrated a significantly aggravated weight loss which was 11
accompanied by significantly increased bacterial loads in the liver (543.3 ± 491.7 12
vs. 41,703 ± 18,498), in the ileum (4.9 x 106 ± 3.2 x 106 vs. 2.2 x 109 ± 7.8 x 108) as 13
well as in the spleen (166.7 ± 87.7 vs. 22,175 ± 9,693; Fig. 5g+h). No significant 14
differences in bacterial loads were observed in cecum, colon or mesenteric lymph 15
nodes (Suppl. Fig. 2a+b). Immunohistochemical analyses indicated that STM 16
infection in mice resulted in inflammatory changes characterized by increased 17
leukocyte infiltrates, tissue destruction and the presence of edema limited to the 18
cecum but being absent in the ileum and colon. (Fig. 5i; data not shown). Further, 19
histological inflammatory disease activity of the cecum reflected by leukocyte 20
infiltration and morphological damage was significantly increased (2.0 ± 0.5 vs. 6.0 21
± 0.0) in mice being immunized against GP2 prior STM infection compared to non- 22
immunized mice (Fig. 5j).
23 24
17 4 Discussion
1
Although autoantibodies against various different antigens including GP2 and its i- 2
soforms have been described in association to distinct IBD phenotypes their patho- 3
physiological relevance still remain elusive [13, 16, 22, 29, 30]. In the present study 4
we found evidence that autoantibodies directed against GP2 reduces its FimH bin- 5
ding capacity and lead to aggravation in a Salmonella Typhimurium mouse model.
6
This may be the result of an impaired humoral immune response to flagellated bac- 7
teria as previously demonstrated by gp2 deficient mice [7]. Of note, in contrast to 8
the data published by Hase et al. that demonstrated significantly decreased 9
invasion of Salmonella Typhimurium into Peyer’s patches as well as mesenteric 10
lymph nodes in gp2 deficient mice, we observed in the present study increased 11
numbers of Salmonella Typhimurium in liver, ileum and the spleen without 12
differences in cecum, colon and mesenteric lymph nodes in mice immunized 13
against GP2. Complete silencing of gp2 in mice seems to inhibit adherence of 14
Salmonella Typhimurium to Peyer’s patches as well as its presentation to local 15
mesenteric lymph nodes. Otherwise, autoimmunity against intestinal expressed 16
GP2 does not affect local adherence of Salmonella Typhimurium to the colonic 17
epithelium but increases adherence and/or invasion into the ileal compartment 18
being accompanied by enhanced presentation to systemic immunological 19
compartments reflected by the liver and the spleen. To conclude, while Hase et al.
20
concentrated on the analysis of Peyer’s patches and mesenteric lymph nodes but 21
not of other intestinal compartments, we did not focused on Peyer’s patches but on 22
the whole ileal compartment, meaning that blockade of FimH binding to M cell 23
expressed GP2#4 via autoantibodies may prevent presentation of the respective 24
bacteria to Peyer’s patches but enhances adherence to mannose residues 25
presented by other ileal epithelial cells. This hypothesis is in line with previous 26
findings revealing the Peyer’s patches to be not critical for presentation of orally 27
applied antigens to mesenteric lymph nodes or the spleen [31]. However, one 28
should highlight the common finding of our study and the study performed by Hase 29
et al. that loss of function of GP2 results in an impaired immune response to 30
flagellated bacteria.
31
Notably, E. coli-derived FimH protein was identified to bind to GP2#4 but not to 32
GP2#2 with IBD sera being able to prevent this binding. Based on the finding that 33
GP2#4 displays a lower amount of a-D-mannose residues in comparison to GP2#2 34
18 (Suppl. Fig. 1) one may hypothesize that the loss of this ‘unique domain’ in GP2#4 1
induces a conformation change in protein structure that allows the remaining N 2
glycosylation sites presented in GP2#4 protein to be better surface exposed in 3
comparison to GP2#2, thereby allowing efficient FimH binding. Previous studies also 4
presented data revealing GP2 as a receptor for bacterial type-1 fimbriae (FimH) with 5
Salmonella- and E. coli-derived FimH proteins displaying strongest binding capacities 6
[32]. An IBD-relevant role of GP2#4 is supported by the finding that only this variant 7
and not GP2#2 expression was detected in the intestines. The M-cell specific expres- 8
sion pattern of murine GP2 has been already proposed in a previous study that de- 9
monstrated GP2 to act as an M-cell specific receptor for FimH positive bacteria to in- 10
duce translocation of these bacteria to the underlying Peyer’s patches for proper in- 11
duction of adaptive immune responses [7]. In the present study, mice that developed 12
autoantibodies of the IgG but not of the IgA isotype against both human GP2 variants 13
after immunization with the homologues human GP2 protein displayed exacerbated 14
STM infection in comparison to non-immunized mice. In should be noted that the 15
presence of such antibodies correlate with the observed phenotype, however other 16
underlying mechanistic hypotheses (e.g. low grade inflammation, altered immunity 17
against other microbial strains) cannot currently be excluded. The finding that 18
immunization of mice with human GP2 protein in the absence of any adjuvant 19
triggers high autoimmunity points to high immunogenic property of human GP2 and is 20
in line with results received from immunization experiments with its structural 21
homolog Tamm-Horsfall protein (THP) in a rabbit model of tubulointerstitial nephritis 22
[33, 34, 35]. Mayrer et al. demonstrated that intravenous application of THP induced 23
elevation of serum IgG antibodies specifically binding to the THP binding epitope of 24
uropathogenic E. coli, thereby leading to exacerbated chronic nephritis. While 25
antibodies of the IgA isotype are mostly abundant in the intestinal mucosa, also IgG 26
antibodies are localized to the lamina propria and that are transported from the 27
basolateral membrane of intestinal epithelial cells to the apical cell surface via the 28
neonatal Fc receptor (FcRn). Hence, intestinal IgG antibodies have been 29
demonstrated to be crucially involved in mucosal defense against invading 30
commensal or pathogens [36, 37]. Further, data received from the in vivo mouse 31
model performed in the present study point to an impaired induction of mucosal 32
immune responses against FimH positive STM in the presence of GP2 directed auto- 33
antibodies, that prevent binding of FimH protein to M-cell expressed GP2#4. The 34
19 presence of GP2-directed autoantibodies in line with impaired immunity might also 1
explain the IBD associated occurrence of FimH positive adherent-invasive E.coli 2
which have been mainly found at the site of Peyer’s patches [38] and suggested to 3
contribute to IBD’s pathophysiology [5, 39, 40].
4
Moreover, we found in vitro GP2#4 expression being induced only by FimH and 5
TNFa but not by other distinct bacteria-derived stimulants such as LD-MDP, peptido- 6
glycan, LPS or flagellin. Based on the finding that TNFa is the predominant cytokine 7
present in IBD patients [41] we suggest that high TNFa level result in increased 8
GP2#4 expression and hence increase the risk to develop GP2-directed autoantibo- 9
dies. Of note, this hypothesis may be further reinforced by the finding that CD pa- 10
tients with an ileocolonic disease manifestion that underwent anti-TNFa therapy dis- 11
played decreased autoantibody level against both GP2 variants in the present study.
12
Additionally, TNFa has been previously shown to enhance intestinal M-cell differenti- 13
ation in a receptor activator of NF-kB ligand (RANKL)- and tumor necrosis factor re- 14
ceptor-associated factor 6 (TRAF6)-dependent manner in murine small intestinal or- 15
ganoids as indicated by the expression of the mature M cell marker GP2 [42, 43].
16 17
4.1 Conclusion 18
In conclusion, elevated GP2-directed autoantibody level detected in IBD patients inhi- 19
bit detection of adherent invasive bacteria via M- and potentially L-cell expressed 20
GP2#4, resulting in impaired induction of mucosal immune response and hence in 21
exacerbated intestinal inflammation. Moreover, we hypothesize that high TNFa and 22
FimH level found in IBD patients promote GP2-directed autoantibody development 23
via excessive intestinal GP2#4 expression. Hence, the blockade or depletion of 24
GP2#4-directed autoantibodies by anti-idiotype antibodies may constitute a novel 25
strategy in the therapy of IBD patients still having developed GP2-directed 26
autoimmunity and being resistant to anti-TNFa therapy. However, the complex 27
interplay between TNFa, intestinal GP2 as well as flagellated bacteria in the context 28
of IBD’s pathophysiology still needs to be investigated in further animal studies.
29 30
5 Acknowledgement 31
20 We would like to thank Ms. Ann-Kathrin Brethack, Ms. Heidi Schlichting, and Ms.
1
Maren Hicken for excellent technical assistance as well as Ms. Janin Braun for her 2
expert help in animal experiments. The Inflammatory Bowel disease of South-Eastern 3
Norway (IBSEN) Study group is acknowledged for providing patient sera.
4 5
6 Funding 6
This work was supported by the Else-Kröner-Fresenius-Stiftung, Bad Homburg, 7
Germany (Research grant 2013-A202 to CS) and an intramural research fellowship 8
from the University of Lübeck.
9 10
7 Author contributions 11
SD and CS designed the concept of the present study and supervised it. AB, DB, 12
JRH, HS and CS collected and provided human sera and biopsy samples. SD, AKB, 13
CP, STJ, TN, GAG acquired the data. SD, AKB, GAG analyzed and interpreted the 14
data. SD and CS drafted the article. AB, DB, GAG, CS and SD critically revised the 15
article for important intellectual content. All authors read and approved the final 16
manuscript.
17 18
8 Conflict of interests 19
Thomas Nitzsche is employed by Euroimmun Corp., Lübeck, Germany. All other 20
authors have no financial conflicts of interest.
21
21 9 References
1
1 Schaeffer C, Santambrogio S, Perucca S, Casari G, Rampoldi L. Analysis of uromodulin 2
polymerization provides new insights into the mechanisms regulating ZP domain-mediated protein 3
assembly. Molecular biology of the cell 2009;20:589-99.
4
2 Yu S, Michie SA, Lowe AW. Absence of the major zymogen granule membrane protein, GP2, 5
does not affect pancreatic morphology or secretion. J Biol Chem 2004;279:50274-9.
6
3 Brunati M, Perucca S, Han L, Cattaneo A, Consolato F, Andolfo A, et al. The serine protease 7
hepsin mediates urinary secretion and polymerisation of Zona Pellucida domain protein uromodulin.
8
eLife 2015;4:e08887.
9
4 Hoops TC, Rindler MJ. Isolation of the cDNA encoding glycoprotein-2 (GP-2), the major 10
zymogen granule membrane protein. Homology to uromodulin/Tamm-Horsfall protein. J Biol Chem 11
1991;266:4257-63.
12
5 Palmela C, Chevarin C, Xu Z, Torres J, Sevrin G, Hirten R, et al. Adherent-invasive Escherichia 13
coli in inflammatory bowel disease. Gut 2018;67:574-87.
14
6 Ohno H, Hase K. Glycoprotein 2 (GP2): grabbing the FimH bacteria into M cells for mucosal 15
immunity. Gut Microbes 2010;1:407-10.
16
7 Hase K, Kawano K, Nochi T, Pontes GS, Fukuda S, Ebisawa M, et al. Uptake through 17
glycoprotein 2 of FimH(+) bacteria by M cells initiates mucosal immune response. Nature 18
2009;462:226-30.
19
8 Gullberg E, Soderholm JD. Peyer's patches and M cells as potential sites of the inflammatory 20
onset in Crohn's disease. Ann N Y Acad Sci 2006;1072:218-32.
21
9 Fukuoka S. Molecular cloning and sequences of cDNAs encoding alpha (large) and beta 22 (small) isoforms of human pancreatic zymogen granule membrane-associated protein GP2.
23
Biochimica et biophysica acta 2000;1491:376-80.
24
10 Roggenbuck D, Hausdorf G, Martinez-Gamboa L, Reinhold D, Buttner T, Jungblut PR, et al.
25
Identification of GP2, the major zymogen granule membrane glycoprotein, as the autoantigen of 26
pancreatic antibodies in Crohn's disease. Gut 2009;58:1620-8.
27
11 Juste C, Kreil DP, Beauvallet C, Guillot A, Vaca S, Carapito C, et al. Bacterial protein signals are 28
associated with Crohn's disease. Gut 2014;63:1566-77.
29
12 Stocker W, Otte M, Ulrich S, Normann D, Stocker K, Jantschek G. [Autoantibodies against the 30
exocrine pancreas and against intestinal goblet cells in the diagnosis of Crohn's disease and ulcerative 31
colitis]. Dtsch Med Wochenschr 1984;109:1963-9.
32
13 Komorowski L, Teegen B, Probst C, Aulinger-Stocker K, Sina C, Fellermann K, et al.
33
Autoantibodies against exocrine pancreas in Crohn's disease are directed against two antigens: The 34
glycoproteins CUZD1 and GP2. J Crohns Colitis 2012.
35
14 Bogdanos DP, Rigopoulou EI, Smyk DS, Roggenbuck D, Reinhold D, Forbes A, et al. Diagnostic 36
value, clinical utility and pathogenic significance of reactivity to the molecular targets of Crohn's 37
disease specific-pancreatic autoantibodies. Autoimmun Rev 2011;11:143-8.
38
15 Pavlidis P, Romanidou O, Roggenbuck D, Mytilinaiou MG, Al-Sulttan F, Liaskos C, et al. Ileal 39
inflammation may trigger the development of GP2-specific pancreatic autoantibodies in patients 40
with Crohn's disease. Clin Dev Immunol 2012;2012:640835.
41
16 Michaels MA, Jendrek ST, Korf T, Nitzsche T, Teegen B, Komorowski L, et al. Pancreatic 42
Autoantibodies Against CUZD1 and GP2 Are Associated with Distinct Clinical Phenotypes of Crohn's 43
Disease. Inflammatory bowel diseases 2015;21:2864-72.
44
17 Jendrek ST, Gotthardt D, Nitzsche T, Widmann L, Korf T, Michaels MA, et al. Anti-GP2 IgA 45
autoantibodies are associated with poor survival and cholangiocarcinoma in primary sclerosing 46
cholangitis. Gut 2017;66:137-44.
47
18 Lunder AK, Hov JR, Borthne A, Gleditsch J, Johannesen G, Tveit K, et al. Prevalence of 48
Sclerosing Cholangitis Detected by Magnetic Resonance Cholangiography in Patients With Long-term 49
Inflammatory Bowel Disease. Gastroenterology 2016;151:660-9 e4.
50
22 19 Olive M, Untawale S, Coffey RJ, Siciliano MJ, Wildrick DM, Fritsche H, et al. Characterization 1
of the DiFi rectal carcinoma cell line derived from a familial adenomatous polyposis patient. In Vitro 2
Cell Dev Biol 1993;29A:239-48.
3
20 Siegmund B, Lehr HA, Fantuzzi G, Dinarello CA. IL-1 beta -converting enzyme (caspase-1) in 4
intestinal inflammation. Proc Natl Acad Sci U S A 2001;98:13249-54.
5
21 Rober N, Noss L, Goihl A, Reinhold D, Jahn J, de Laffolie J, et al. Autoantibodies Against 6
Glycoprotein 2 Isoforms in Pediatric Patients with Inflammatory Bowel Disease. Inflammatory bowel 7
diseases 2017;23:1624-36.
8
22 Roggenbuck D, Rober N, Bogdanos DP, Goihl A, Reinhold D, Conrad K, et al. Autoreactivity to 9
isoforms of glycoprotein 2 in inflammatory bowel disease. Clin Chim Acta 2015;442:82-3.
10
23 Cummings D, Cruise M, Lopez R, Roggenbuck D, Jairath V, Wang Y, et al. Loss of tolerance to 11
glycoprotein 2 isoforms 1 and 4 is associated with Crohn's disease of the pouch. Aliment Pharmacol 12
Ther 2018;48:1251-9.
13
24 Jovine L, Darie CC, Litscher ES, Wassarman PM. Zona pellucida domain proteins. Annu Rev 14
Biochem 2005;74:83-114.
15
25 Terahara K, Yoshida M, Igarashi O, Nochi T, Pontes GS, Hase K, et al. Comprehensive gene 16
expression profiling of Peyer's patch M cells, villous M-like cells, and intestinal epithelial cells. J 17
Immunol 2008;180:7840-6.
18
26 Worthington JJ, Reimann F, Gribble FM. Enteroendocrine cells-sensory sentinels of the 19
intestinal environment and orchestrators of mucosal immunity. Mucosal Immunol 2018;11:3-20.
20
27 Swidsinski A, Ladhoff A, Pernthaler A, Swidsinski S, Loening-Baucke V, Ortner M, et al.
21
Mucosal flora in inflammatory bowel disease. Gastroenterology 2002;122:44-54.
22
28 Kotlowski R, Bernstein CN, Sepehri S, Krause DO. High prevalence of Escherichia coli 23
belonging to the B2+D phylogenetic group in inflammatory bowel disease. Gut 2007;56:669-75.
24
29 Smids C, Horjus Talabur Horje CS, Groenen MJM, van Koolwijk EHM, Wahab PJ, van Lochem 25
EG. The value of serum antibodies in differentiating inflammatory bowel disease, predicting disease 26
activity and disease course in the newly diagnosed patient. Scand J Gastroenterol 2017;52:1104-12.
27
30 Paul S, Boschetti G, Rinaudo-Gaujous M, Moreau A, Del Tedesco E, Bonneau J, et al.
28
Association of Anti-glycan Antibodies and Inflammatory Bowel Disease Course. J Crohns Colitis 29
2015;9:445-51.
30
31 Kunkel D, Kirchhoff D, Nishikawa S, Radbruch A, Scheffold A. Visualization of peptide 31
presentation following oral application of antigen in normal and Peyer's patches-deficient mice. Eur J 32
Immunol 2003;33:1292-301.
33
32 Schierack P, Rodiger S, Kolenda R, Hiemann R, Berger E, Grzymajlo K, et al. Species-specific 34
and pathotype-specific binding of bacteria to zymogen granule membrane glycoprotein 2 (GP2). Gut 35
2015;64:517-9.
36
33 Mayrer AR, Kashgarian M, Ruddle NH, Marier R, Hodson CJ, Richards FF, et al.
37
Tubulointerstitial nephritis and immunologic responses to Tamm-Horsfall protein in rabbits 38
challenged with homologous urine or Tamm-Horsfall protein. J Immunol 1982;128:2634-42.
39
34 Berke ES, Mayrer AR, Miniter P, Andriole VT. Tubulointerstitial nephritis in rabbits challenged 40
with homologous Tamm-Horsfall protein: the role of endotoxin. Clin Exp Immunol 1983;53:562-72.
41
35 Mayrer AR, VT A. The Role of Antigenic Cross-Reactions Between Tamm-Horsfall Protein and 42
Uropathic Coliforms in the Immunopathogenesis of Interstitial Nephritis. In: H Losse, AW Asscher, AE Lison, 43
Andriole V, eds. In Pyelonephritis Vol V, Urinary Tract Infections. Stuttgart-New York: Georg Thieme 44
Verlag and Thieme-Stratton, Inc Publishers, 1984:30-9.
45
36 Horton RE, Vidarsson G. Antibodies and their receptors: different potential roles in mucosal 46
defense. Front Immunol 2013;4:200.
47
37 Castro-Dopico T, Clatworthy MR. IgG and Fcgamma Receptors in Intestinal Immunity and 48
Inflammation. Front Immunol 2019;10:805.
49
38 Chassaing B, Rolhion N, de Vallee A, Salim SY, Prorok-Hamon M, Neut C, et al. Crohn disease-- 50
associated adherent-invasive E. coli bacteria target mouse and human Peyer's patches via long polar 51
fimbriae. J Clin Invest 2011;121:966-75.
52