Title Analysis of the Atlantic salmon genome reveals a cluster of Mx genes that respond more strongly to IFN gamma than to type I IFN
Article type Full Length Article Abstract
Mx proteins are antiviral GTPases, which are induced by type I IFN and virus infection. Analysis of the Atlantic salmon genome revealed the presence of 9 Mx genes localized to three chromosomes. A cluster of three Mx genes (SsaMx1 – SsaMx3), which includes previously cloned Mx genes, is present on chromosome (Chr) 12. A cluster of five Mx genes (SsaMx4-SsaMx8) is present on Chr25 while one Mx gene (SsaMx9) is present on Chr9. Phylogenetic and gene synteny analyses showed that SsaMx1-SsaMx3 are most closely related to the main group of teleost Mx proteins. In contrast, SsaMx 4-SsaMx9 formed a separate group together with zebrafish MxD and MxG and eel MxB.
The Mx cluster in Chr25 showed gene synteny similar to a Mx gene cluster in the gar genome. Expression of Mx genes in cell lines stimulated with recombinant IFNs showed that Mx genes in Chr12 responded more strongly to type I IFN than to type II IFN (IFN gamma) whilst Mx genes in Chr25 responded more strongly to IFN gamma than to type I IFNs. SsaMx9 showed no response to the IFNs.
Keywords Antiviral; Evolution; Interferon; Innate immunity; Fish; Mx Manuscript category Vertebrate
Corresponding Author Borre Robertsen
Order of Authors Borre Robertsen, Linn Greiner-Tollersrud, Lars Gaute Jorgensen
Submission Files Included in this PDF
File Name [File Type]
Coverletter Mx paper 2018.docx [Cover Letter]
Highlights salmon Mx genes.docx [Highlights]
Mx genes in the salmon genome 190618 .docx [Manuscript File]
Fig.1. Salmon Mx alignment 25.05.18.pdf [Figure]
Fig.2. Vertebrate Mx tree 02.05.18e.pdf [Figure]
Fig.3. Mx gene synteny 030518.tif [Figure]
Fig.4 expression SSP9.tif [Figure]
Fig.5.Expression IFNg.tif [Figure]
Fig.6.Promoter regions.docx [Figure]
Table 1. Mx primers.docx [Table]
Table 2.Mx genes in the Atlantic salmon genome.docx [Table]
Table 3. % identity.docx [Table]
To view all the submission files, including those not included in the PDF, click on the manuscript title on your EVISE Homepage, then click 'Download zip file'.
Gaute Jørgensen, entitled “Analysis of the Atlantic salmon genome reveals a cluster of Mx genes that respond more strongly to IFN gamma than to type I IFN”, which is being submitted for possible publication in Developmental and Comparative Immunology. This work showed that Atlantic salmon possesses three clusters of Mx genes on different chromosomes. A cluster of three Mx genes (SsaMx1 – SsaMx3) is present on chromosome (Chr) 12. Two of these genes have been cloned and studied in a previous work. A cluster of five Mx genes (SsaMx4-SsaMx8) was found on Chr25 while one Mx gene (SsaMx9) was found on Chr9. In this work we have studied the evolution of these Mx genes and studied their expression in response to type I IFN and type II IFN (IFN gamma). As expected for Mx-genes, SsaMx1- SsaMx3 responded more strongly to type I IFN than to IFN gamma. Surprisingly, however, SsaMx4-SsaMx8 responded more strongly to IFN gamma than to type I IFN, which is a novel feature of Mx genes.
Sincerely yours, Prof. Børre Robertsen
1. Atlantic salmon was shown to possess 9 Mx genes located on three chromosomes: Chr12 (SsaMx1-SsaMx3), Chr25 (SsaMx4-SsaMx8) and Chr9 (SsaMx9).
2. Phylogenetic and gene synteny analyses showed that SsaMx1-SsaMx3 belong to the main group of teleost Mx genes.
3. SsaMx4-SsaMx9 formed a separate group together with zebrafish MxD and MxG and eel MxB.
4. Expression studies showed that Mx genes in Chr12 responded more strongly to type I IFN than to IFN gamma while Mx genes in Chr25 responded more strongly to IFN gamma than to type I IFNs.
5. SsaMx9 showed no response to IFNs.
1 Title: Analysis of the Atlantic salmon genome reveals a cluster of Mx genes that 2 respond more strongly to IFN gamma than to type I IFN
3
4 Authors: Børre Robertsen*, Linn Greiner Tollersrud and Lars Gaute Jørgensen 5
6 Norwegian College of Fishery Science, UiT The Arctic University of Norway, 9037 7 Tromsø, Norway
8
9 *Corresponding author.
10 E-mail address: borre.robertsen@uit.no (B. Robertsen) 11
12
13 Abstract
14 Mx proteins are antiviral GTPases, which are induced by type I IFN and virus 15 infection. Analysis of the Atlantic salmon genome revealed the presence of 9 Mx 16 genes localized to three chromosomes. A cluster of three Mx genes (SsaMx1 – 17 SsaMx3), which includes previously cloned Mx genes, is present on chromosome 18 (Chr) 12. A cluster of five Mx genes (SsaMx4-SsaMx8) is present on Chr25 while 19 one Mx gene (SsaMx9) is present on Chr9. Phylogenetic and gene synteny analyses 20 showed that SsaMx1-SsaMx3 are most closely related to the main group of teleost Mx 21 proteins. In contrast, SsaMx 4-SsaMx9 formed a separate group together with
22 zebrafish MxD and MxG and eel MxB. The Mx cluster in Chr25 showed gene 23 synteny similar to a Mx gene cluster in the gar genome. Expression of Mx genes in 24 cell lines stimulated with recombinant IFNs showed that Mx genes in Chr12 25 responded more strongly to type I IFN than to type II IFN (IFN gamma) whilst Mx 26 genes in Chr25 responded more strongly to IFN gamma than to type I IFNs. SsaMx9 27 showed no response to the IFNs.
28 29
30 Keywords: Antiviral; Evolution; Interferon; Innate immunity; Fish; Mx 31
32 Abbreviations
33 Aa, amino acids; Chr, chromosome; GAS, gamma-activated sequence; IFN, 34 interferon; ISG, interferon stimulated gene; ISRE, interferon-stimulated signalling 35 element; Mx, myxovirus resistance; nt, nucleotides; RT-qPCR, reverse transcription 36 quantitative PCR
37
38 1. Introduction
39 Mx proteins are antiviral GTPases, which play an important role in innate antiviral 40 immunity of vertebrates (Haller et al., 2015; Verhelst et al., 2013). They were first 41 discovered in influenza resistant mice. This resistance was shown to be inherited as a 42 single dominant trait named Mx1+, for myxovirus resistance, and is dependent on a 43 single gene encoding the Mx1 protein (Horisberger et al., 1983). Mx proteins have 44 since been found in most vertebrates and are typically induced by type I IFN, double- 45 stranded RNA (dsRNA) and virus infection (Robertsen, 2018; Verhelst et al., 2013).
46 While Mx proteins are highly conserved, they show antiviral specificity between 47 species and are either localized to the cytoplasma or the nucleus (Haller et al., 2015;
48 Verhelst et al., 2013). Mouse Mx1 protein is localized in the nucleus and mainly 49 inhibits orthomyxoviruses. In contrast, human MxA protein is localized in the 50 cytoplasm and inhibits a variety of RNA viruses. Although the antiviral mechanisms 51 of Mx proteins are yet not fully understood, crystallographic evidence suggests that 52 mammalian Mx proteins form tubular aggregates, which trap virus nucleocapsids 53 resulting in inhibition of transcription of the virus genome (Haller et al., 2010).
54 While mammals possess 1-3 Mx genes, fish possess 0-9 Mx genes dependent on 55 species (Solbakken et al., 2016; Verhelst et al., 2013). Some fish species such as 56 Atlantic cod in fact lack Mx genes (Solbakken et al., 2016). Fish Mx proteins were 57 first characterized in rainbow trout, which was shown to possess three Mx proteins, 58 named RBTMx1, RBTMx2 and RBTMx3 (Trobridge et al., 1997; Trobridge and 59 Leong, 1995). RBTMx1 and RBTMx3 are localized in the cytoplasm while RBTMx2 60 is localized in the nucleus. Antiviral activity of fish Mx proteins was first established 61 for Atlantic salmon Mx1 protein against IPNV and has since been demonstrated for 62 Mx proteins from several fish species against various virus types (Alvarez-Torres et
63 al., 2013; Caipang et al., 2003; Larsen et al., 2004; Lester et al., 2012; Lin et al., 2006;
64 Wu et al., 2010). Atlantic salmon was originally found to possess three Mx proteins 65 named ASMx1, ASMx2 and ASMx3 where ASMx1 and ASMx2 have 96 % sequence 66 identity and show strong homology to RBTMx1 while ASMx3 is homologous to 67 RBTMx3 (Robertsen et al., 1997; Trobridge and Leong, 1995). In this work we
68 screened the Atlantic salmon genome for Mx genes and found that salmon possesses 9 69 Mx genes localized to three chromosomes. A cluster of three Mx genes is present on 70 chromosome (Chr) 12 and includes the previously cloned salmon Mx genes. A cluster 71 of five Mx genes is present on Chr25 while one Mx gene is present on Chr9. We have 72 compared the salmon Mx genes and the proteins sequences and analysed their
73 evolution. Moreover, we have demonstrated that the three groups of salmon Mx 74 proteins have different expression properties in response to type I IFN and type II 75 IFN. Mammalian type I IFNs signal through a heterodimeric receptor composed of 76 the IFNAR1 and IFNAR2 chains (Stark et al., 1998). This results in phosphorylation 77 and dimerization of signal transducer and activator of transcription (STAT) 1 and 78 STAT2 proteins, which interacts with IRF9 to form transcription factor ISGF3.
79 Subsequently, ISGF3 translocates into the nucleus and activates transcription of 80 hundreds of IFN-stimulated genes (ISGs) by binding to the interferon-stimulated 81 signalling element (ISRE). Type II IFN is identical to IFN gamma (IFNg), which 82 signals through another heterodimeric receptor resulting in phosphorylation and 83 dimerization of STAT1 only (Stark et al., 1998). The STAT1 homodimer typically 84 activates gene transcription by binding to gamma-activated sequences (GAS).
85 Accordingly, type I IFNs and IFNg show different patterns of gene activation. The 86 ISRE consensus sequence is present in the promoter of both mouse Mx1 and rainbow 87 trout Mx1 (Collet and Secombes, 2001; Hug et al., 1988). The predominant Atlantic
88 salmon type I IFNs are IFNa, IFNb and IFNc, which all induce the salmon Mx1 gene 89 (Svingerud et al., 2012). Atlantic salmon Mx1 is induced much more strongly by 90 IFNa than IFNg (Sun et al., 2011). Surprisingly, the present work shows that Mx 91 genes encoded by Chr25 are more strongly induced by IFNg than by IFNa.
92
93 2. Materials and methods 94 2.1. Bioinformatics
95 All sequences annotated as Mx were extracted from the Atlantic salmon genome 96 (NCBI Reference Sequence Database (RefSeq) assembly accession:
97 GCF_000233375.4). To identify Mx genes in the Atlantic salmon genome, 98 TBLASTN using the salmon ASMx1 sequence (GenBank accession U66475) as 99 query was performed against Atlantic salmon chromosomes in the NCBI database.
100 Nuclear localization signal (NLS) in salmon Mx proteins was predicted using the 101 NucPred program at http://www.sbc.su.se/~maccallr/nucpred/. Multiple alignment of 102 the salmon Mx genes was performed with the ClustalW method in the MegAlign 103 program (DNASTAR, Inc.). The alignment was used to obtain sequence distances (%
104 identity). Phylogenetic analysis of vertebrate Mx genes was performed by multiple 105 alignment of sequences using Clustal W in the MEGA7 program (Kumar et al., 2016).
106 A phylogenetic tree was the constructed from the alignment using the Neighbor- 107 joining method (Kumar et al., 2016; Saitou and Nei, 1987).
108
109 2.2. Cells
110 ASK cells derived from Atlantic salmon (Salmo salar L.) head kidney (Devold et al., 111 2000) were purchased from American Type Culture Collection. SSP-9 cells derived 112 from head kidney of Atlantic salmon were obtained from Dr. Perez-Prieto (Centro de
113 Investigaciones Biológicas, CSIC, C/Ramiro de Maeztu 9, 28040, Madrid, Spain) 114 (Rodriguez Saint-Jean et al., 2014). Both cell lines were grown at 20°C in L-15 115 medium (Gibco) containing 1x MEM Non-Essential Amino Acid Solution 116 (Invitrogen), 100 U/ml penicillin, 100 µg/ml streptomycin and 8% FBS Superior 117 (Biochrom AG).
118
119 2.3. Stimulants
120 Poly I:C (polyinosinic polycytidylic acid) was obtained from GE Healthcare Life 121 Sciences. Recombinant IFNa and IFNc were produced in HEK293 cells as described 122 (Svingerud et al., 2012). IFNg was produced in E. coli (Sun et al., 2011).
123
124 2.4. Stimulation of cells
125 SSP-9 cells (1.2x105 cells/well) and ASK cells (105 cells/well) were seeded in 1 ml 126 medium in 24 well culture plates. Cells in triplicate wells were stimulated
127 extracellularly with 10 µg/ml poly I:C, 1000 U/ml IFNa, 1000 U/ml IFNc or 1 ng/ml 128 IFNg for 24 and 48 h. Cells were stimulated intracellularly with 1 µg/ml poly I:C for 129 24 and 48 h using FuGene HD transfection Reagent according to the the
130 manufacturers (Promega).
131
132 2.5. Gene expression analysis by reverse transcription quantitative PCR (RT-qPCR) 133 RNA was isolated from cells using RNeasy Mini Kit (Qiagen) by lysing cells in each 134 well with 350 µl RLT buffer and extracting RNA as described by the manufacturer.
135 cDNA was synthesized with the QuantiTect Reverse Transcription Kit (Qiagen) 136 starting with 100 ng total RNA following standard protocol. qPCR was performed 137 using 6.0 μl 1:5 dilution of cDNA in a 15-μl reaction mixture containing 7.5 μl Fast
138 SYBR® Green Master Mix (Thermo Fisher Scientific) and 400 nM forward and 139 reverse primers (Table 1). Each sample was run in duplicate wells on a 7500 Fast 140 Real-Time PCR System (Applied Biosystems). The mixtures were incubated at 95°C 141 for 20 s, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s. The absence of 142 primer–dimer artifacts was confirmed by running melting curve step. Relative 143 expression values were normalized against the levels of Elongation Factor 1αB 144 (EF1αB) mRNA. Fold increase of the representative genes was calculated by
145 comparison of gene expression in treated versus untreated cells. Relative expression 146 of Mx genes was calculated by the Pfaffl method using EF1αB as a reference gene 147 (Pfaffl, 2001). Data were calculated from triplicates of three samples in each group, 148 and expressed as mean ± standard errors. The primers used in RT-qPCR are listed in 149 Table 1. Unpaired t-test with two-tail distribution was used for statistical analysis, 150 p ≤ 0.05.
151
152 3. Results 153
154 3.1. Identification of Mx genes in the Atlantic salmon genome
155 To identify Mx genes in the Atlantic salmon genome, TBLASTN using the salmon 156 ASMx1 gene as query, was performed against Atlantic salmon chromosomes (Chr) in 157 the NCBI GenBank database. The search resulted in identification of three Mx genes 158 in Chr12, five Mx genes in Chr25 and one Mx gene in Chr9. All genes and the 159 deduced proteins are listed in Table 2. Chr12 contains one Mx gene, which encodes a 160 protein corresponding to the previously cloned ASMx1 and ASMx2 proteins
161 (Robertsen et al., 1997). This confirms that they are encoded by alleles of the same 162 gene rather than separate genes. We propose to name the encoded protein SsaMx1,
163 which is homologous to rainbow trout (RBT) Mx1 (Accession no. AAA87839).
164 Another Mx gene in Chr 12 encodes a protein corresponding to ASMx3, which is 165 homologous to RBTMx3 (Accession no. AAC60215). We propose to name this 166 protein SsaMx3. The third Mx gene in Chr 12 encodes a protein homologous to the 167 RBTMx2 protein (Accession no. AAC60214), and has not been identified before. We 168 propose to name this gene SsaMx2. While SsaMx1 and SsaMx3 both contain 623 169 amino acids (aa), SsaMx2 contains 638 aa due to an insert as described for RBTMx2.
170 A nuclear localization signal (NLS) RKRKR was predicted for SsaMx2 at amino acid 171 number 506-510, similar to the NLS of RBTMx2 (Trobridge et al., 1997). None of the 172 other salmon Mx proteins appeared to contain NLS.
173 The nomenclature of the Mx proteins encoded by Chr25 is suggested to be 174 SsaMx4 to SsaMx8, and SsaMx9 for the Mx protein encoded by Chr9 (Table 2). The 175 Mx proteins encoded by Chr25 vary in size from 603 to 627 aa while SsaMx9 in Chr9 176 contains 642 aa and is the largest of the salmon Mx proteins. A multiple alignment of 177 the salmon Mx proteins (Fig. 1) showed that they all contain conserved regions which 178 are typical for vertebrate Mx proteins (Verhelst et al., 2013). These include a GTPase 179 region in the N-terminal half with the highly conserved tripartite GTP-binding
180 sequence element consisting of GDQSSGKS, DLPG and TKPD; the dynamin
181 signature LPRGS/TGIVTR; and a leucine zipper motif in the C-terminal (Verhelst et 182 al., 2013). Besides the leucine zipper motif, the C-terminal half of Mx proteins from 183 Chr12 is very different from the Mx proteins of Chr25 and Chr9. This may be of 184 importance for their antimicrobial activities since it has been shown that the C termini 185 of mammalian Mx proteins are responsible for recognition of viral targets and for 186 their differential antiviral activities (Verhelst et al., 2013). Mx proteins encoded by 187 Chr12 showed 86-97 % identity among themselves. Overall, Mx proteins encoded by
188 Chr12 showed only 45 - 48 % amino acid (aa) sequence identity with SsaMx9 189 encoded by Chr9, and 44 - 50% identity with the Mx protein encoded by Chr25 190 (Table 3). SsaMx9 showed 51 - 52 % sequence identity with Mx proteins in Chr25.
191 Mx proteins encoded by Chr25 have 87 to 91 % aa sequence identity among 192 themselves.
193 A phylogenetic analysis was conducted to study the relationship between the 194 three groups of salmon Mx genes and other vertebrate Mx genes. This was done by 195 first creating a multiple alignment using the Clustal W program. A phylogenetic tree 196 was then constructed from the alignment with the Neighbor-joining method using 197 lamprey (Petromyzon marinus) Mx as an outgroup (Fig.2). The tree shows that 198 vertebrate Mx genes form three major groups. The first group includes most teleost 199 Mx genes including SsaMx1, SsaMx2 and SsaMx3. The second group contains Mx 200 genes of tetrapods (amphibians, reptiles, birds and mammals). The third group 201 includes SsaMx4 to SsaMx8 of Chr25 and SsaMx9 in Chr9 plus zebrafish MxD and 202 MxG and eel MxB. Zebrafish MxC and MxE formed a minor group together with one 203 of the gar (Lepisosteus oculatus) Mx proteins in linkage group (LG) 17. The other gar 204 Mx protein in LG17 did not group with any of the three main groups while the gar Mx 205 in LG3 grouped with the lamprey Mx.
206 Gene synteny studies supported that salmon Mx genes encoded by Chr12 are 207 related to the main group of teleost Mx genes except zebrafish, being linked to the 208 SYNPR, THOC7 and ATXN7 genes (Fig.3). In contrast, salmon Mx genes in Chr25 209 are flanked by the STXBP5L and HPX genes similar to the two Mx genes in LG17 in 210 the gar genome. Salmonids thus seem to have kept one of the ancestral Mx clusters.
211 The seven Mx genes found in zebrafish are organised among four clusters where Mxc 212 and Mxe are linked to HPX whilst the other zebrafish Mx clusters show no likeness in
213 gene synteny with other Mx genes (Solbakken et al., 2016). SsaMx9 in Chr9 neither 214 showed obvious likeness in gene synteny with other Mx genes. Interestingly, the gar 215 Mx gene in LG3 is flanked by the FAM3B and TMPRSS2 genes similar to the Mx 216 genes of tetrapods.
217 The presence of salmon Mx genes on three chromosomes may be the result of 218 the teleost and salmonid specific whole genome duplications (WGD). However, it is 219 interesting to note that even the spotted gar, which is a non-teleost bony fish that 220 originates from fish before the teleost specific WGD, possesses Mx gene clusters in 221 two linkage groups. FAM3B and TMPRSS2 as flanking genes to Mx have been 222 maintained in gar LG3 and tetrapods, but not in the major teleost groups (Solbakken 223 et al., 2016). The possibility exists, however, that rearrangements in an ancestral 224 teleost have replaced FAM3B and TMPRSS2 with SYNPR, THOC7 and ATXN7 as 225 flanking genes since as described below, SsaMx1, SsaMx2 and SsaMx3 respond 226 similarly to type I IFN as their mammalian homologs. In teleosts, Mx flanked by 227 STXBP5L and HPX has apparently only been observed in Atlantic salmon, but 228 zebrafish also possesses two Mx genes linked to HPX (Solbakken et al., 2016).
229
230 3.2. Expression of Mx genes in response to stimulation with poly I:C, IFNa and IFNc 231 TBLASTN with each salmon Mx protein as query against the Atlantic salmon EST 232 database showed that SsaMx1, SsaMx2 and SsaMx3 gave at least 36 positive hits 233 with ≥ 64 % sequence identity and an E-value ≤ 2e-36. In contrast, SsaMx4, SsaMx5, 234 SsaMx6, SsaMx7 and SsaMx9 gave no positive hits and SsaMx8 gave one positive 235 hit. This suggests that SsaMx4-SsaMx9 are even more strictly regulated than 236 SsaMx1-SsaMx3. To compare expression properties of the different Mx genes,
237 Atlantic salmon cell lines were stimulated with IFNa, IFNc, IFNg and poly I:C, which
238 mimics viral dsRNA. In the first experiment SSP-9 cells were stimulated 239 extracellularly with 10 µg/ml poly I:C, 1000 U/ml IFNa or 1000 U/ml IFNc, or 240 stimulated intracellularly by transfection with 1 µg/ml poly I:C. Mx expression was 241 measured by RT-qPCR after 24 and 48 hours (Fig. 4). The results showed that Mx 242 genes in Chr12 were increased by all treatment using the primer pair SsaMx123, 243 which amplifies all three Mx genes, SsaMx1, SsaMx2 and SsaMx3. SsaMx4 and 244 SsaMx5 in Chr25 were also increased by these treatments, but to a lesser extent than 245 Mx genes in Chr12. In general, the responses were higher at 48 h than at 24 h for all 246 Mx genes in Chr12 and Chr25. The difference in response at 24 vs 48 h were largest 247 for poly I:C, possibly due to induction of IFNa. In contrast, SsaMx9 in Chr9 showed 248 no significant response to any of the treatments (p≤0.05).
249 In the next experiment we wanted to compare the response of the different Mx 250 genes to IFNa and IFNg. For this purpose, we also designed specific primers for 251 SsaMx2 and SsaMx8 and used both SSP-9 and ASK cells. As expected, SsaMx123 252 and SsaMx2 primers showed stronger up-regulation of Mx in response to IFNa than to 253 IFNg in both cell types. Surprisingly, however, SsaMx4, SsaMx5 and SsaMx8
254 showed a much stronger response to IFNg than to IFNa in both cell types. SsaMx8 255 showed by far the strongest response to both IFNg and IFNa, followed by SsaMx5 256 and SsaMx4. The fold up-regulation of SsaMx8 with IFNg and IFNa was 3867 vs 162 257 in ASK cells and 1621 vs 54 in SSP-9 cells. In contrast, the fold up-regulation of 258 SsaMx2 with IFNg and IFNa was 27 vs 1153 in ASK cells and 5 vs 49 in SSP-9 cells.
259 Even if the concentrations of IFNa and IFNg are not comparable, the ratios of the 260 responses to these IFNs are clearly different for Mx genes in Chr12 and Chr25.
261 SsaMx9 responded significantly neither to IFNa nor to IFNg (p≤0.05). Taken 262 together, SsaMx1, SsaMx2 and SsaMx3 are typical type I IFN responsive genes,
263 which respond less to IFNg as observed before (Sun et al., 2011). In contrast, 264 SsaMx4, SsaMx5 and SsaMx8 are more typical IFNg responsive genes than type I 265 IFN responsive genes. This is apparently the first identification of vertebrate Mx 266 genes that are more responsive to IFNg than to IFNa. In mammals, Mx genes are 267 strictly induced by type I and type III IFN and are not induced by IFNg or other 268 cytokines (Haller et al., 2015; Verhelst et al., 2013). Type III IFN has not yet been 269 identified in fish. In Atlantic salmon, Mx genes of Chr12 are up-regulated by IFNg, 270 but this in part due to up-regulation of IFNa (Sun et al., 2011). Some type I IFN 271 induced genes such as viperin, may be up-regulated by IFNg through induction of 272 IRF-1 (Stirnweiss et al., 2010). Whether this is the case for the salmon Mx genes in 273 Chr25 is not known.
274
275 3.3. ISRE and GAS motifs in Mx promoter regions
276 In mammals, ISRE and GAS sequences are the main promoter elements, which 277 control transcription of genes induced by type I IFNs and IFNg, respectively.
278 Henceforth, it was of interest to search for such motifs in promoter regions of the 279 salmon Mx genes. The ISRE consensus sequence of mammalian ISGs is GAAAN1-
280 2GAAA or its inverse complement (Hug et al., 1988). The GAS consensus sequence 281 is TTCN2-4GAA (Decker et al., 1997). The promoter of rainbow trout Mx1 gene 282 contains the element GAAAGTGAAAC, which matches the ISRE consensus (Collet 283 and Secombes, 2001). To identify ISRE elements in salmon Mx genes, 500
284 nucleotides (nt) upstream of the ATG translation start site were screened manually for 285 the ISRE and GAS consensus sequences (Fig. 6). For SsaMx1 an ISRE motif was 286 found 304-312 nt upstream of ATG while a putative GAS motif was found 254-263 nt 287 upstream of ATG. For SsaMx2, an ISRE motif was found 365-374 nt upstream of
288 ATG and a putative GAS motif was found 414-423 nt upstream of ATG. For SsaMx3, 289 an ISRE motif was found 245-254 nt upstream of ATG and a putative GAS motif was 290 identified 274-283 nt upstream of ATG. Compared to the ISRE element in the
291 rainbow trout Mx1 promoter, SsaMx2 and SsaMx3 possess identical ISRE sequences 292 while the ISRE element of SsaMx1 lacks one G.
293 NCBI gene bank predicts a 10083 nt intron interruption of the SsaMx8 mRNA 294 5´-UTR region. A similar prediction is made for the mRNA of SsaMx4, but not for 295 SsaMx5. Accordingly, the transcription start sites of these Mx genes are uncertain and 296 need to be confirmed by experimental determination in order to confirm the
297 respective promoter regions. In the present work the sequence 500 nt upstream of the 298 transcription start sites of SsaMx4 - SsaMx8 predicted by NCBI GenBank, were 299 analysed for ISRE and GAS motifs. The SsaMx8 sequence contained two putative 300 GAS motifs and two ISRE motifs while the SsaMx4 sequence contained one GAS 301 and one ISRE motif (Fig.6). No ISRE or GAS motifs were detected in the 500 nt 302 sequences upstream of the predicted mRNAs for SsaMx5, SsaMx6, SsaMx7 or 303 SsaMx9 (not shown).
304 At present the true role of ISRE-elements and GAS elements for the type I 305 IFN response and IFNg response in salmonids is not known. The reporter studies of 306 rainbow trout Mx1 has apparently only been performed with a sequence 584 nt 307 upstream of translation start site (Collet and Secombes, 2001). The importance of 308 GAS-elements in the promoters of IFNg responsive genes in rainbow trout could not 309 be established (Castro et al., 2008). In fact, promoter regions containing ISRE motifs 310 responded stronger to IFNg than promoter regions containing GAS motifs. Thus, 311 while STAT1 phosphorylation and dimerization in response to IFN gamma has been 312 demonstrated in salmonids (Skjesol et al., 2010), the IFNg responsive elements have
313 yet to be defined. Whether the strong response of SsaMx8 to IFNg is due to
314 possession of two ISRE and/or two GAS motifs has to be studied in reporter assays.
315 In the case of the IFNg responsive genes, it must be taken into account that IFNg may 316 also up-regulate genes through induction of transcription factors, such as known for 317 IRF-1 (Stirnweiss et al., 2010; Storm van's Gravesande et al., 2002).
318
319 4. Concluding remarks
320 The prominent antiviral properties of Mx proteins opens the possibility for an 321 antiviral role also for the Mx proteins of Chr25, which might be examined by
322 establishment of cell lines constitutively expressing these proteins. On the other hand, 323 Mx genes induced by IFNg might have different functions compared to type I IFN 324 induced Mx genes. In mammals, the GTPases guanylate binding proteins (GBPs) and 325 p47 immunity regulated GTPases (IRGs) are among the most abundant IFNg-induced 326 proteins. Both provide cell-autonomous resistance against a variety of intracellular 327 bacterial and eukaryotic pathogens (Kim et al., 2011; Pilla-Moffett et al., 2016). GBPs 328 also possess antiviral activity although the antiviral properties are weak compared to 329 those of the Mx proteins (Haller et al., 2015). It would thus be interesting to examine 330 if the Mx proteins encoded by Chr25 possess similar antimicrobial activities as GBPs 331 and IRGs. The antimicrobial activity of GBPs and IRGs are linked with their ability to 332 associate with pathogen-containing vacuoles, followed by recruitment of certain 333 binding partners (Pilla-Moffett et al., 2016). Recently, it was found that GBPs protect 334 against bacterial infections by interacting with phagocyte oxidase, antimicrobial 335 peptides and autophagy effectors (Kim et al., 2011). Targeting of GBPs to membrane- 336 bound compartments is due to isoprenylation, but is dispensable for targeting of GBPs 337 to pathogen-containing vacuoles is dispensable (Pilla-Moffett et al., 2016). Rainbow
338 trout GBP also possesses an isoprenylation motif CaaX at the C-terminus (Robertsen 339 et al., 2006). None of the salmon Mx proteins contain CaaX motifs (Fig. 1). It would 340 still be important to examine if SsaMx4-SsaMx8 reside in the cytoplasma or if they 341 are associated with pathogen-associated vacuoles.
342 343
344 References
345 Alvarez-Torres, D., Garcia-Rosado, E., Fernandez-Trujillo, M.A., Bejar, J., Alvarez, 346 M.C., Borrego, J.J., Alonso, M.C., 2013. Antiviral specificity of the Solea 347 senegalensis Mx protein constitutively expressed in CHSE-214 cells. Mar 348 Biotechnol (NY) 15, 125-132.
349 Caipang, C.M., Hirono, I., Aoki, T., 2003. In vitro inhibition of fish rhabdoviruses 350 by Japanese flounder, Paralichthys olivaceus Mx. Virology 317, 373-382.
351 Castro, R., Martin, S.A., Bird, S., Lamas, J., Secombes, C.J., 2008. Characterisation of 352 gamma-interferon responsive promoters in fish. Mol Immunol 45, 3454-
353 3462.
354 Collet, B., Secombes, C.J., 2001. The rainbow trout (Oncorhynchus mykiss) Mx1 355 promoter. Structural and functional characterization. Eur J Biochem 268,
356 1577-1584.
357 Decker, T., Kovarik, P., Meinke, A., 1997. GAS elements: A few nucleotides with a 358 major impact on cytokine-induced gene expression. J Interf Cytok Res 17,
359 121-134.
360 Haller, O., Gao, S., von der Malsburg, A., Daumke, O., Kochs, G., 2010. Dynamin- 361 like MxA GTPase: structural insights into oligomerization and implications 362 for antiviral activity. J Biol Chem 285, 28419-28424.
363 Haller, O., Staeheli, P., Schwemmle, M., Kochs, G., 2015. Mx GTPases: dynamin-like 364 antiviral machines of innate immunity. Trends Microbiol 23, 154-163.
365 Horisberger, M.A., Staeheli, P., Haller, O., 1983. Interferon induces a unique 366 protein in mouse cells bearing a gene for resistance to influenza virus. Proc 367 Natl Acad Sci U S A 80, 1910-1914.
368 Hug, H., Costas, M., Staeheli, P., Aebi, M., Weissmann, C., 1988. Organization of the 369 murine Mx gene and characterization of its interferon- and virus-inducible 370 promoter. Mol Cell Biol 8, 3065-3079.
371 Kim, B.H., Shenoy, A.R., Kumar, P., Das, R., Tiwari, S., MacMicking, J.D., 2011. A 372 family of IFN-gamma-inducible 65-kD GTPases protects against bacterial 373 infection. Science 332, 717-721.
374 Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular Evolutionary 375 Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33, 1870-
376 1874.
377 Larsen, R., Rokenes, T.P., Robertsen, B., 2004. Inhibition of infectious pancreatic 378 necrosis virus replication by atlantic salmon Mx1 protein. J Virol 78, 7938-
379 7944.
380 Lester, K., Hall, M., Urquhart, K., Gahlawat, S., Collet, B., 2012. Development of an 381 in vitro system to measure the sensitivity to the antiviral Mx protein of fish 382 viruses. J Virol Methods 182, 1-8.
383 Lin, C.H., Christopher John, J.A., Lin, C.H., Chang, C.Y., 2006. Inhibition of nervous 384 necrosis virus propagation by fish Mx proteins. Biochemical and
385 biophysical research communications 351, 534-539.
386 Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real- 387 time RT-PCR. Nucleic acids research 29, e45.
388 Pilla-Moffett, D., Barber, M.F., Taylor, G.A., Coers, J., 2016. Interferon-Inducible 389 GTPases in Host Resistance, Inflammation and Disease. J Mol Biol 428,
390 3495-3513.
391 Robertsen, B., 2018. The role of type I interferons in innate and adaptive
392 immunity against viruses in Atlantic salmon. Dev Comp Immunol 80, 41-52.
393 Robertsen, B., Trobridge, G., Leong, J.A., 1997. Molecular cloning of double- 394 stranded RNA inducible Mx genes from Atlantic salmon (Salmo salar L.).
395 Dev Comp Immunol 21, 397-412.
396 Robertsen, B., Zou, J., Secombes, C., Leong, J.A., 2006. Molecular and expression 397 analysis of an interferon-gamma-inducible guanylate-binding protein from 398 rainbow trout (Oncorhynchus mykiss). Dev Comp Immunol 30, 1023-1033.
399 Rodriguez Saint-Jean, S., Gonzalez, C., Monras, M., Romero, A., Ballesteros, N., 400 Enriquez, R., Perez-Prieto, S., 2014. Establishment and characterization of a 401 new cell line (SSP-9) derived from Atlantic salmon Salmo salar that
402 expresses type I ifn. J Fish Biol 85, 1526-1545.
403 Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for 404 reconstructing phylogenetic trees. Mol Biol Evol 4, 406-425.
405 Skjesol, A., Hansen, T., Shi, C.Y., Thim, H.L., Jorgensen, J.B., 2010. Structural and 406 functional studies of STAT1 from Atlantic salmon (Salmo salar). BMC 407 Immunol 11, 17.
408 Solbakken, M.H., Rise, M.L., Jakobsen, K.S., Jentoft, S., 2016. Successive Losses of 409 Central Immune Genes Characterize the Gadiformes' Alternate Immunity.
410 Genome Biol Evol 8, 3508-3515.
411 Stark, G.R., Kerr, I.M., Williams, B.R., Silverman, R.H., Schreiber, R.D., 1998. How 412 cells respond to interferons. Annu Rev Biochem 67, 227-264.
413 Stirnweiss, A., Ksienzyk, A., Klages, K., Rand, U., Grashoff, M., Hauser, H., Kroger, 414 A., 2010. IFN regulatory factor-1 bypasses IFN-mediated antiviral effects 415 through viperin gene induction. J Immunol 184, 5179-5185.
416 Storm van's Gravesande, K., Layne, M.D., Ye, Q., Le, L., Baron, R.M., Perrella, M.A., 417 Santambrogio, L., Silverman, E.S., Riese, R.J., 2002. IFN regulatory factor-1
418 regulates IFN-gamma-dependent cathepsin S expression. J Immunol 168,
419 4488-4494.
420 Sun, B., Skjaeveland, I., Svingerud, T., Zou, J., Jorgensen, J., Robertsen, B., 2011.
421 Antiviral activity of salmonid gamma interferon against infectious
422 pancreatic necrosis virus and salmonid alphavirus and its dependency on 423 type I interferon. J Virol 85, 9188-9198.
424 Svingerud, T., Solstad, T., Sun, B., Nyrud, M.L., Kileng, O., Greiner-Tollersrud, L., 425 Robertsen, B., 2012. Atlantic salmon type I IFN subtypes show differences 426 in antiviral activity and cell-dependent expression: evidence for high 427 IFNb/IFNc-producing cells in fish lymphoid tissues. J Immunol 189, 5912-
428 5923.
429 Trobridge, G.D., Chiou, P.P., Leong, J.A., 1997. Cloning of the rainbow trout 430 (Oncorhynchus mykiss) Mx2 and Mx3 cDNAs and characterization of trout 431 Mx protein expression in salmon cells. J Virol 71, 5304-5311.
432 Trobridge, G.D., Leong, J.A., 1995. Characterization of a rainbow trout Mx gene. J 433 Interferon Cytokine Res 15, 691-702.
434 Verhelst, J., Hulpiau, P., Saelens, X., 2013. Mx proteins: antiviral gatekeepers that 435 restrain the uninvited. Microbiol Mol Biol Rev 77, 551-566.
436 Wu, Y.C., Lu, Y.F., Chi, S.C., 2010. Anti-viral mechanism of barramundi Mx against 437 betanodavirus involves the inhibition of viral RNA synthesis through the 438 interference of RdRp. Fish Shellfish Immunol 28, 467-475.
439
440 Figure legends
441 Figure 1. Multiple alignment of Atlantic salmon Mx proteins. Amino acids that are 442 identical with those of SsaMx1 are shaded with black.
443
444 Figure 2. Phylogenetic tree of vertebrate Mx proteins. Included in the analysis were 445 Mx proteins from representative species of teleost fish, mammals (human and mouse), 446 birds (chicken Gallus gallus), reptiles (green anole lizard Anolis carolinensis) and 447 amphibians (frog Xenopus laevis). Mx proteins from the non-teleost bony fish spotted 448 gar (Lepisosteus oculatus) and of lamprey (Petromyzon marinus) were also included 449 and the latter was used to root the tree. The evolutionary history of the Mx genes was 450 inferred using the Neighbor-Joining method within the MEGA7 program and shows 451 the bootstrap consensus tree. The percentage of replicate trees in which the associated 452 taxa clustered together in the bootstrap test (1000 replicates) are shown next to the 453 branches. The evolutionary distances were computed using the Poisson correction 454 method and are in the units of the number of amino acid substitutions per site. All 455 positions containing gaps and missing data were eliminated. NCBI accession numbers 456 are shown for all species except lamprey and stickleback Mx, which are from the 457 Ensemble database. Accession numbers for the salmon Mx proteins are shown in 458 Table 2. RBT = rainbow trout.
459
460 Figure 3. Local gene synteny analysis of Atlantic salmon Mx regions compared to 461 Mx regions in selected teleost species, the non-teleost bony fish spotted gar
462 (Lepisosteus oculatus), frog (Xenopus tropicalis) and human. Gene synteny in the 463 Atlantic salmon and gar linkage groups were obtained from NCBI GenBank using the 464 Mx accession numbers depicted in Fig.2. Gene synteny for stickleback Mx1 and Mx2, 465 zebrafish Mxc and Mxd, frog and human were obtained from Solbakken et al
466 (Solbakken et al., 2016).
467
468 Figure 4. Expression of Mx genes in SSP-9 cells in response to IFNa, IFNc and poly 469 I:C. Cells in triplicate wells were stimulated extracellularly with 10 µg/ml poly I:C 470 (PICs), 1000 U/ml IFNa or 1000 U/ml IFNc for 24 and 48 h. Cells were stimulated 471 intracellularly by transfection with 1 µg/ml poly I:C (PICt) for 24 and 48 h.
472 Expression of genes were measured by RT-qPCR. Data are presented as mean fold 473 increase in transcripts +/- SD relative to non-treated cells. SsaMx1,2,3 means increase 474 in transcripts using the primer set that up-regulates all three genes SsaMx1, SsaMx2 475 and SsaMx3.
476
477 Figure 5. Expression of Mx genes in ASK and SSP-9 cells in response to IFNa (1000 478 U/ml) or IFNg (1ng/ml). Cells in triplicate wells were stimulated for 24 h.
479 Expression of genes were measured by RT-qPCR. Data are presented as mean fold 480 increase in transcripts +/- SD relative to non-treated cells.
481
482 Figure 6. ISRE and GAS motifs in promoter regions of Mx genes.
483 ISRE motifs are shown in bold upper case letters while GAS motifs are
484 shown in bold lower case letters. For SsaMx8, an additional ISRE is underlined. For 485 SsaMx1, SsaMx2 and SsaMx3, the 500 nt sequence upstream of the translation start 486 site is shown where normal upper case letters indicate mRNA. For SsaMx4 and 487 SsaMx8 the 500 nt sequences upstream of the putative intron in the 5´-untranslated 488 region of mRNA are shown.
M T Q Q A T C L P E S I H S L K R K R D M S Y E D G P R M F Q D Q L A E K V R P F I D L I D D M R S I G I D K E L P L P T I A V V G D Q S S 70 SsaMx6
- - - M F Q D Q L A E K V R P F I D L I D D M R S I G I D K E L P L P T I A V V G D Q S S 42 SsaMx7
- - - M S H D D G P R M F Q D Q L A E K V R P F I D L V D D M R S I G I D K E L P L P T I V V V G D Q S S 50 SsaMx8
- - - M H R P G A G S E D E E R Y R D G M Q S G V F Y S H L D R Q V R P F I E L I D F L R S I G I E K D L A L P A I A V V G D Q S S 63 SsaMx9
G K S S V L E A L S G V A L P R G S G I V T R C P L E L K M K R K K E G E E W H G K I S Y Q - D H E E E I E D P S D V E K K I R E A Q D E M 114 SsaMx1
G K S S V L E A L S G V A L P R G S G I V T R C P L E L K M K R K K E G E E W H G K I R Y Q - D R E E E I E D P S D V E K K I R K A Q D E M 114 SsaMx2
G K S S V L E A L S G V A L P R G S G I V T R C P L E L K M K R K K E G E E W H G K I S Y Q - D H E E E I E D P S D V E K K I R E A Q D E M 114 SsaMx3
G K S S V L E T L S G V A L P R G T G I V T R C P L L L Q L C N D R - T V K W E A V I S Y G - E K V F D F D E P S E V V N H V E Q A Q N E L 118 SsaMx4
G K S S V L E T L S G V A L P R G T G I V T R C P L L L Q L C N D R - T V K W E A V I S Y G G K F R N E F D E P S E V V R H V E Q A Q N T L 119 SsaMx5
G K S S V L E T L S G V A L P R G T G I V T R C P L L L Q L C K D R - T V K W E A V I S Y R - D K V N E F D E P S E V V R Y V E Q A Q S A L 138 SsaMx6
G K S S V L E T L S G V S L P R G T G I V T R C P L L L Q L C N D R - T V K W E A V I S Y R - D K V N E F D E P S E V V R H V E Q A Q N A L 110 SsaMx7
G K S S V L E T L S G V A L P R G T G I V T R C P L L L Q L C N D R - T V K W E A V I S Y G - G K F N E F D D P S E V V R Y V E Q A Q N A L 118 SsaMx8
G K S S V L E A L S G V A L P R G S G I V T R C P L E L K L R K S F - G G K W K A K I S Y Q - G V V E T F E D P S L V E I H V R T A Q N T L 131 SsaMx9
A G V G V G I S D D L I S L E I G S P D V P D L T L I D L P G I A R V A V K G Q P E N I G E Q I K R L I R K F I T K Q E T I N L V V V P C N 184 SsaMx1
A G V G V G I S D D L I S L E I G S P D V P D L T L I D L P G I A R V A V K G Q P E N I G E Q I K N L I R K F I T K Q E T I N L V V V P C N 184 SsaMx2
A G V G V G I S D D L I S L E I G S P D V P D L T L I D L P G I A R V A V K G Q P E N I G E Q I K R L I R K F I M K Q E T I N L V V V P C N 184 SsaMx3
A G E G L G I C E H L I T L K I T S S M V C D L S L I D L P G I A R V A V K G Q P D D I G A Q I K N L I L K F I K N K R T I I L V V V P C N 188 SsaMx4
A G K G V G I C E D L I T L K I T S S T V C D L S L I D L P G I T R V A V K G Q P D D I G A Q I K N L I S K F I K N K R T I I L V V V P C N 189 SsaMx5
A G K G V G I C E D L I T L K I T S S M V C D L S L I D L P G I T R V A V K G Q P D D I G A Q I K N L I S K F I K N K R T I I L V V V P C N 208 SsaMx6
A G K G V G I C E D L I T L K I T S S T V C D L S L I D L P G I T R V A V K G Q P D D I G A Q I K N L I S K F I K N K R T I I L V V V P C N 180 SsaMx7
A G K G V G I C E D L I T L K I T S S T V C D L S L I D L P G I T R V A V K G Q P D D I G A Q I N H L I R K F I K E K R T I I L V V V P C N 188 SsaMx8
A G D G V G I C D D L I T L E I T S P D V C D L T L I D L P G I T R V P V T G Q P E D I G D Q I R R L I L K F I K K Q E T I N L V V V P C N 201 SsaMx9
V D I A T T E A L K M A Q E V D P E G E R T L G I L T K P D L V D K G T E E T V V D I V H N E V I H L T K G Y M I V K C R G Q K E I M E R V 254 SsaMx1
V D I A T T E A L K M A Q E V D P Q G G R T L G I L T K P D L V D K G T E E M V V D I V H N E V I H L T K G Y M I V K C R G Q K E I M E Q V 254 SsaMx2
V D I A T T E A L K M A Q E V D P E G E R T L G I L T K P D L V D K G T E E T V V D I V H N E V I H L T K G Y M I V K C R G Q K E I M E R V 254 SsaMx3
V D I A T T E A L K M A Q E V D P E G T R T Q A I L T K P D L I D P G A E K N V L E I V H N K V V F L N M G Y V I V K C R G Q K N I D E N M 258 SsaMx4
V D I A T T E A L K M A Q E M D P E S T R T L A I L T K P D L I D P G A E K N V L E I V H N K V I F L N M G Y V I V K C R G Q K Q I D E N M 259 SsaMx5
V D I A T T E A L K M A Q E V D P E G T R T L A I L T K P D L I D Q G A E K N V L E I V H N K V I F L N M G Y V I V K C R G Q K Q I D E N M 278 SsaMx6
V D I A T T E V L K M A Q E V D P E G T R T L A I L T K P D L I D P G A E K N V L E I V H N K V V F L N M G Y V I V K C R G Q K Q I D E N M 250 SsaMx7
V D I A T T E A L K M A Q E V D P E G T R T L A I L T K P D L I D P G A E K N V L E I V H N K V I I L N M G Y V I V K C R G Q K Q I D E N M 258 SsaMx8
V D I A T T E A L R M A Q S V D P E G A R T L A I L T K P D L V D K G A E P D I L K I V N G Q V V H L N K G Y I I V K C R G Q N D I N Q K I 271 SsaMx9
S L S E A T E R E K A F F K E H A H L S T L Y D E G H A T I P K L A E K L T L E L V H H I E K S L P R L E E Q I E A K L A E T H A E L E R Y 324 SsaMx1
S L T E A T E R E K A F F K E H L H L S T L Y D E G H A T I P K L A E K L T L E L V Q H I E K S M P R L K E Q I E E K L E E T R T T L E K C 324 SsaMx2
S L T E A T E R E K A F F K E H A H L S T L Y D E G H A T I P K L A E K L T I E L V H H I E K S L P R L E E Q I E A K L A E T H A E L E R Y 324 SsaMx3
S I T D A I E E E L E F F Q N H E H F R S L L R E E K A S T K C L A T K L S N A L V K H I K K S L P Q M S A T I K E R L V E V K H L L S Q I 328 SsaMx4
S I T R A I E E E L E F F Q N H E H F R S L L R E E K A S T K C L A N K L S N A L V N H I K K S L P Q M S A T I K E R L V E V K H L L S K L 329 SsaMx5
S I T C A I E E E L E F F R N H E H F R S L L R E E K A T T K C L A T K L S N A L V N E I K K Y L P K M S E N I K E Q M G E V K H L L S Q I 348 SsaMx6
S I T G A I E E E L E F F R N H E H F R S L L R E E K A T T K C L A T K L S N A L V N Q I K K Y L P K I S E K I K E K L G H V K H S L S Q I 320 SsaMx7
S I T H A I E E E L E F F R N H E H F R S L L H E E K A T T K C L A N K L S N A L V K H I K K S L P K M S K K I K E Q L G E V K H L L S Q I 328 SsaMx8
S L A D A T R L E M E F F K N H H H F S P L L E Q N K V T T Q C L A T K L T Q D L V D H I K T S L P Y L T D Q I R E H L E T V K T E L K K Y 341 SsaMx9
G T G P P E D S A E R M Y F L I D K V T A F T H D A I N L S T G E E L K S G V R L N V F S T L R K E F G K W K L H L D H S G E N F N Q R I E 394 SsaMx1
G T G P P E D P K E R Q Y F L I D K V T L F T Q D V I N L S T G E E L K S G D - I N I F S T L R T E F G K W K A Q L D R S G K N F N K K I E 393 SsaMx2
G T G P P E D S A E R M Y F L I D K V T A F T H D A I N L S T G E E L K N G V R L N V F S T L R K E F G K W K L H L E H S G E N F N Q R I E 394 SsaMx3
E D R P P L E P E E K R K Y L I Q V I T D F N D Q I T Q L S N G D M I V E E N - - - L F E L M R K E F T E W M K C L E N A K S H Y H E V V Q 395 SsaMx4
E G G P P L E P E E K R K Y L I Q V I T D F N D Q I T Q L S K G D I I V E E N - - - L F V L M R K E F A E W M K C L Q N D K S N Y H K V V Q 396 SsaMx5
E S G P P L Q P A E K R K Y L I Q V I T D F N D Q I T Q L S K G D I I V V E H - - - L F E L M R K E F T E W M E C L K N A K S N Y H K V V Q 415 SsaMx6
E S G P P L E P A E K R K Y L I Q V I T E F N E Q I T Q L S K G D I I V E E N - - - L F E L M G K E F A E W M K C L E N A K S N Y H E V V Q 387 SsaMx7
E S G S P L E P A E K R K Y L I Q V I T D F N D Q I T Q L S K G D I I V E E N - - - L F E L M R K E F T E W M E C L K N A K S H Y H E V V Q 395 SsaMx8
S T G P P L E R K K M G P Y L T E R L M D F I D K I H E L C R I G N S S E K N - - - L Y T F L R P V F Q Q W D S Y L S N T K G S F L N K V E 408 SsaMx9
G E V A D Y E K T S R G R E L P G F I N Y K T F E V M V K D Q I K Q L E E P A V K K L N Q I S D A V R E V F L L L A Q S S F I G F P N L L K 464 SsaMx1
K E V A D Y E K T Y R G R E L P G F I N Y K T F E V M V K D Q I K Q L E E P A V K K L K E L S D V A R K A F I L L A Q N S F T G F P I L L K 463 SsaMx2
G E V A D Y E K T Y R G R E L P G F I N Y K T F E V M V K D Q I K Q L E E P A V K K L K E I S D A V R K V F L L L A Q S S F I G F P N L L K 464 SsaMx3
Q V V D E Y D Q K H R G S E L P G F S N Y R V F Q R V V Q K L V A E L K R P A M M T L Q T I R D M V Q K Q F D H L S R E S F K N Y P Y L H R 465 SsaMx4
Q V V D E Y D Q K H R G S E L P G F S N Y R V F Q R V V Q K L V A E L K R P A M T T L Q I I R D M V Q K Q F D H L S K E C F K N Y P Y L H Q 466 SsaMx5
Q V V D E Y D Q K H R G S E L P G F T N Y R V F Q H V V Q K L V A E L K N P A M M T L Q K I R D M V Q K Q F N H L S R E S F K N Y P Y L H Q 485 SsaMx6
Q V V D E Y D Q K H R G S E L P G F S N Y R V F Q H V V Q K L V A E L K R P A M M T L Q K I K D M V Q K Q F Y I L S R E R F K N H P F L H Q 457 SsaMx7
Q V V D E Y D Q K H R G S E L P G F T N Y R V F Q H V V Q K L V A E L K N P A M M T L Q K I R D M V Q K Q F D N L S R E S F K N Y P Y L H Q 465 SsaMx8
A M I K N Y D K E H R G R E L I T F S D Y C V Y E H A V Q K H I L G L Q E P A L D V L K A I R D M V Q A E F R H V C E A C F K S Y P Q L R C 478 SsaMx9
S A K T K I E A I K Q V N E S T A E S M L R T Q F K M E M I V Y T Q D S T Y S H S L S E R K R E E E D D R P - - - 518 SsaMx1
T A K T K I E T I K Q E K E S T A E S M L R T Q F K M E L I V Y T Q D I T Y S S S L R K R K R E E E E L E E G E L V K N P S L S F G S Q K V 533 SsaMx2
S A K T K I E A I K Q V N E S T A E S M L R T Q F K M E L I V Y T Q D S T Y S H S L S E R K R E E E E D E D - - - 518 SsaMx3
V S M R K N E T I Q E K Q S T I V K E R I V E Q F E M E M Q V Y T Q D E I F N K - - - H S 507 SsaMx4
V S M R N I E T I Q E Q Q S N I V K E R I V E Q F E M E M Q V Y T Q D E I F N K - - - I I 508 SsaMx5
V S M K N I E T I Q E Q Q S T I V K E R I V E Q F E M E M Q V Y T Q D E I F N K - - - H I 527 SsaMx6
V S K K N I E T I Q E K Q S I I V K E R I V E Q F Q M E M Q V Y T Q D E I F N K - - - H I 499 SsaMx7
V S K K K I E T I Q E N Q S T I V K E R I V E Q F Q M E M Q V Y T Q D E I F N K - - - H I 507 SsaMx8
L A L T K I D E I Q M K Q E A K V E K R I K E Y I N M E R L V Y T Q D S I F V K G L K D H K D Q L K E A F E E E H F - - - Y D 538 SsaMx9
L P T I K I R S T I F S T D N H A T L Q E M M L H L K S Y Y R I S S Q R L A D Q I P M V I R Y L V L Q E F A S Q L Q R E M L Q T L Q E K D N 588 SsaMx1
L S V F S V R S T V N G H D N H A A L R E M M L H L K S Y Y N I A S Q R L A D Q I P M V I R Y L V L Q E F A S Q L Q R E M L Q T L Q E K D N 603 SsaMx2
K P F S E I R S T I F C T D N H A T L Q E M M L H L K S Y Y S I A S Q R L A D Q I P M V I R Y L V L Q E F A S Q L Q R E M L Q T L Q E K D N 588 SsaMx3
R M E G - T A E G - - - - S V H D T R S K Y P E L L K A Y Y E I V V Q R L A D Q V P M L I S Y F I L K Q S A K I V C S E M L D L L H - R D D 571 SsaMx4
L E E G E I A E D - - - - K D K D T R G K Y P G L L K A Y Y E I V V Q R L A D Q V P M M I C Y F I L K Q S A K I V C S E M L D L L H - R D D 573 SsaMx5
L E E G K T A G G - - - - K E H D T R S K Y P G L L K A Y Y E I V V Q R L A D Q V P M L I S Y F M L K E S A K I V C S E M L D L L S - R D D 592 SsaMx6
L E E G E T A A D P S D C S D E D T R S K Y P G L L K A Y Y E I V V Q R L A D Q V P M L I R Y F I L K Q S A K I V C S E M L D L L H - R D D 568 SsaMx7
P K E G E T A A G - - - - S D K D T R S K Y P G L L K A Y Y E I V V Q R L A D Q V P M L I R Y F I L K Q S A K I V C S E M L D L L H - R D D 572 SsaMx8
P E E I E D I T A T F N C T A F D S R K L T T D K L G V Y Y E I V Y Q R L A D Y V P M L I L Q F M L K E S A K M L R I Q I M D L R D - G A D 607 SsaMx9
I E Q L L K E D F D I G S K R A A L Q N K L K R L M K A R S Y L V E F 623
SsaMx1
I E Q L L K E D I D I G S K R A S L Q S K L K R L M K A R S Y L V E F 638
SsaMx2
I E Q L L K E D F D I G S K R A S L Q S K L K R L M K A R S Y L V E F 623
SsaMx3
T D N I L Q E D S E I E Q Y R A K L Q A Q L D R L I L A N D K I S S L 606
SsaMx4
T D N I L Q E D S E I G Q Y R A K L L A Q A D R L I L A N D K I S S V 608
SsaMx5
T D N I L Q E D S E I E Q K R A K L K A Q V D R L I L A N D K I S S V 627
SsaMx6
T D D I L Q E D S E I E Q Y R A K L Q A Q A D R L I L A N D K I S S L 603
SsaMx7
T D N I L Q E D S E I G Q Y R A K L L A Q A Y R L I L A N D K I S S L 607
SsaMx8
V V K L L S E D S M E G R R R A D L H Q R L D R L K K A Q E K L S E F 642
SsaMx9
RBTMx1 AAA87839 RBTMx3 AAC60215
SsaMx2
RBTMx2 AAC60214 Fugu Mx AAO37934
Stickleback Mx1 ENSGACT00000012159 Stickleback Mx2 ENSGACT00000012177 Grouper Mx AAS82739
Seabass Mx AER25335 Seabream Mx1 ACK99554 Yellowtail Mx AKN10666 Turbot Mx AAT57877 Flounder Mx BAC76769 Halibut Mx AAF66055
Channel catfish Mx AAM23274 Goldfish Mx AAP68828 Zebrafish MxA CAD67755 Zebrafish MxB CAD67756 Eel MxC KC430926 Eel MxA KC430924 Eel MxD KC430927
Gar Mx LG17 XP_015219404 Human MxA AAA36337 Mouse Mx1 AAA39777 Human MxB AAA36338 Lizard Mx XP_008105696 Chicken Mx NP_989940 Xenopus Mx1 NM_001256769 Gar Mx LG17 XP_015219402 Zebrafish MxC NP_001007285 Zebrafish MxE CAD67759
SsaMx4 SsaMx5 SsaMx7 SsaMx6 SsaMx8 SsaMx9
Eel MxB KC430925 Zebrafish MxG CAD67761 Zebrafish MxD XM_690470 Gar Mx LG3 XP_015196910
Lamprey Mx ENSPMAT00000000296
1 0 0 1 0 0
1 0 0
1 0 0 1 0 0 9 9 9 9 9 7
9 6 9 9
8 6 8 2
6 5 6 7
6 2 1 0 0 6 4 1 0 0 5 5
5 1 5 4 6 1 9 0 8 1
6 6
7 9
1 0 0
7 0 1 0 0 7 0
6 4
9 9
1 0 0
Fig.6.
Caaatgcattgcgctcaatatcagaccacgtcaggcagaccacacaataaacctgaacta gtctatagcttttctagtgagacaggcccatctagtggtgtagcctagaaatgccgccat gtctcacatgtcgttcggtagaattgggtgcagcttccagcttcagcactaacctttaat gaaGAAATGAAAgtggaaaaaccgcttaagtttcgatttccagggatgacactgaacaca cgaaaccggttgtttcacccattataaaacgtgtcgagacgtaaaatctcctgtatcgga gaaaaGGGACACGCAGTGGTCATCAGATAGCAGAACACCTTGCTGTTTATTTAAGTTTTA TCACTAAATAATAATTCACA
SsaMx2
caggtctcttcgctgcctggaggaggaattcagccatgttggttccgacctgtctattag Ggaacatgcttataaaatgttgaaccaacacacacaaacaaaatgtgacctttcctattg Ctcagaaatgctatactcataagtctatctgtgtgcatgatgttaatctgcatattgttg agtctctgccactttgtccgtggtttacagtttaagacatacttaatgtttcacatcaac acgtacaggctgcaagtcaattaattactttctgtcctcaggatggttgagctattgata tttgaaaaatgtatgtaaaatcgagtgagatgaaatactcaggttacttttgtgttggag aaatGAAAGTGAAActatattatggataagtatcgtttccCAGGGATGACTCTTTCTACA GAACCTGTACAGCCAGTAGTCAGTTGCAGTGTAGTCAGTTGCAGTTGCAGTGTATTAACC ATTTTTTTTTATCGCAAATC
SsaMx3
cagtgatatattgggggggacaaatcatatttttcccaggatgggggggtcgtgtccgcc tctgcatcacccctggtgagacaaaaccgcgactcgtcagtgaagagcactttttgccag tcctgtctggtccagcgacggtgggtttgtgcccataggagacgttgttggggaatcctg ccctatagcctcaccgcatcctatggcagcatccagcttcagcactaactttcaattgag acatGAAAGTGAAAcacaccgtgtaagattcgattcccaggaatgatacgccctctgttt tacaaaaccggttgttacaaaaacgagtcgagtaaacactccccctctcGGAGAAGGTAC TGGAGCTGGAGGAGGGAATAGACTACTTTTGAAATATATGCATTGCCAATAATTTCATAT CCTTTCAACATCCGCAGTGGGCATCAGATAACAGAACATCTTGCTTTTTATTTAAGTTTA TCACTAAATAATAATACACA
SsaMx4
Aaactgtacatagttctgtgagtgtcactgagtaggttgatacccatttcatgggtgcac Aatctctagtttagactgcacagtccaatctatgttcaatatgcacaataggctgtgtag Tgagctgatttcgcacggtcaaagtcctgcagctaaaaaactaatatttgtgtaatttct acatagttgtgttctgttaataacactgaggagatagcccatttcatggggacacaatac cccttatactgtgcagtataagtaatcccccattgtaaagtctattacatccacagtggg cttttatcaattttttgtggtagtatgcactttgagaaacaaccttggtttcaatttact ttcttggaaatcatgtgacccttaagaaccaatgaggttgtatctgagatgtgattaggc actttgtaacagatggagtataatggtatgctttccggtaatggaccaccgTTTCACTTT Cattttaccttctataaaag
SsaMx8
gtcactgagtaggctgatacccatttcattggtgcacaatctgtagtttagcctgtatag Tcccaatctgtatgttcaatatgcacaataggctgtgtagtgagctgatttctcacagtc Aaagtcctgcaatgacagctaaaacgctaatatttgtgtaaactctacacaattgtgtcc tgtgcatgtcactgaggagatagcccatttcatggggacacaatccataggttaggctgt gcagtataattattcccccattgtaaagtcaattacatccacagtgggatttcatcagtt ttttttgtatctatctgtagtagaaacaaccttgaTTTCATTTCACTttctgggaaatca tgtgacccttaagaaccaatgaggttatatctgaactttaattatgcactgtgtaacaga tgcagaataatggtatgatttcccagaatggacaatcaaaacgtttcactttcattttgt ttccatgaaaggtgatagac
SsaMx123F TGCAACCACAGAGGCTTTGAA
SsaMx123R GGCTTGGTCAGGATGCCTAAT
SsaMx2F CTGAGGAAGAGGAAGAGGGA
SsaMx2R CAGATAACACTTTCTGACTCCCA
SsaMx4F CAGTGAAATGCTGGATCTGCTACACAG
SsaMx4R GATCCAATTGGGCCTGCAACTTTG
SsaMx5F ATTCTGGAGGAGGGGGAAATAGCAG
SsaMx5R CAGCCAGTCTTTGCACCACAATCTCATA
SsaMx8F GGAGCCCAAATCAATCATCTCATTAGG
SsaMx8R ATTTTCAGGGCCTCTGTTGTTGCTATG
SsaMx9F ATGTTGTCAAACTGCTGAGCGAAGACTCTA
SsaMx9R CACTAAGTTTTTCCTGGGCCTTTTTCAGA
EF1αBF TGCCCCTCCAGGATGTCTAC
EF1αBR CACGGCCCACAGGTACTG
F = forward, R = reverse
Gene ID Proteina Lengthb Chr.12
SsaMx1 LOC100136920 NP_001117162 623 SsaMx2 LOC100136920 NP_001133390 638 SsaMx3 LOC100136587 NP_001117147 623 Chr.25
SsaMx4 LOC106586887 XP_014030089 606
SsaMx5 LOC106586888 XP_014030090 608
SsaMx6 LOC106586889 XP_014030091 627
SsaMx7 LOC106586890 XP_014030092 603
SsaMx8 LOC106586891 XP_014030093 607
Chr.09 SsaMx9 LOC106612969 XP_014070197 642
a GenBank accession numbers
b Number of amino acids
SsaMx number
1 2 3 4 5 6 7 8 9
SsaMx1 100
SsaMx2 86 100
SsaMx3 97 87 100
SsaMx4 49 47 49 100
SsaMx5 49 47 49 91 100
SsaMx6 47 44 47 87 88 100
SsaMx7 50 47 50 88 89 88 100
SsaMx8 49 47 50 90 90 89 90 100
SsaMx9 48 45 48 52 52 51 52 52 100
Calculated from the alignment in Fig. 1 using the MegAlign program.
