Influenza Other Respi Viruses. 2019;1–10. wileyonlinelibrary.com/journal/irv | 1
Received: 20 August 2018
|
Revised: 21 January 2019|
Accepted: 23 January 2019 DOI: 10.1111/irv.12637O R I G I N A L A R T I C L E
Community spread and late season increased incidence of oseltamivir‐resistant influenza A(H1N1) viruses in Norway 2016
Karoline Bragstad
1| Olav Hungnes
1| Irene Litleskare
2| Hans Christian Nyrerød
3| Dagny H. Dorenberg
1| Siri H. Hauge
1This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.
© 2019 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.
1Department of Influenza, Norwegian Institute of Public Health, Oslo, Norway
2Department of Drug Statistics, Norwegian Institute of Public Health, Oslo, Norway
3Department of Anesthesiology, Oslo University Hospital, Rikshospitalet, Oslo, Norway
Correspondence
Karoline Bragstad, Department of Influenza, Division for Infection Control and Environmental Health, Norwegian Institute of Public Health, Oslo, Norway.
Email: [email protected]
Background: Antiviral resistance in Norwegian influenza viruses is rare. Only one A(H1N1)pdm09 virus from May 2015 had been found resistant to oseltamivir since the introduction of these viruses in 2009.
Objectives: Surveillance of antiviral resistance is part of the Norwegian surveillance system, to rapidly detect the development of antiviral‐resistant viruses and spread in the community. We describe the spread of oseltamivir‐resistant A(H1N1)pdm09 vi‐
ruses in Norway in the 2016‐17 season, found as part of the routine surveillance.
Methods: Influenza H1N1 viruses were analysed for antiviral resistance by pyrose‐
quencing, neuraminidase susceptibility assay and by Sanger sequencing of the HA and NA genes.
Results: During the 2015‐16 influenza season, 3% of all A(H1N1)pdm09 viruses screened for resistance in Norway were resistant to oseltamivir, possessing the H275Y substitution in the neuraminidase protein. In comparison, the overall fre‐
quency in Europe was 0.87%. Out of these, 37% (n = 10) were reported from Norway.
Most cases in Norway were not related to antiviral treatment, and the cases were from several different locations of southern Norway. Genetic analysis revealed that resistant virus emerged independently on several occasions and that there was some spread of oseltamivir‐resistant influenza A(H1N1)6B.1 viruses in the community, characterised by a N370S substitution in the haemagglutinin and T48I in the neuraminidase.
Conclusions: Our findings emphasise the importance of antiviral resistance surveil‐
lance in the community, not only in immunocompromised patients or other patients undergoing antiviral treatment.
K E Y W O R D S
antiviral resistance, H275Y, influenza, surveillance
1 | INTRODUCTION
The National Influenza Centre for WHO in Norway (NIC Norway) is the only institution in Norway performing antiviral resistance test‐
ing and surveillance. The national surveillance system for influenza comprises a network of volunteer sentinel physicians and medical microbiology laboratories which report weekly the number of posi‐
tives and the number of specimens tested. Furthermore, they send positive specimens to the NIC for further characterisation. A selec‐
tion of surveillance samples are screened for antiviral resistance by real‐time PCR and sequencing and/or susceptibility to antivirals in neuraminidase inhibition assay. Norway runs a well‐functioning in‐
fluenza surveillance programme that benefits from comprehensive diagnostic testing for influenza at the regional laboratories with over 110 000 samples tested during the 2015/16 season, nearly 15 000 samples of these were found influenza positive. Approximately 3000 of these samples are shipped to the NIC for further character‐
isation and enrolment in the global surveillance. A(H1N1)pdm09 vi‐
ruses (further referred to as H1 or H1N1), subclade 6b.1, dominated the 2015/16 season.
The most commonly used neuraminidase inhibitors (NI)—os‐
eltamivir (Tamiflu®) and zanamivir (Relenza®)—are authorised for use in Norway, but only oseltamivir is available on the market from 2016. The use of antivirals differs globally with the United States and Japan as the major consumers with eight million NI prescrip‐
tions annually in Japan.1 Antivirals are not widely used in Norway and mainly recommended for at‐risk and severely ill patients, with approximately one course sold pr 1000 inhabitants in 2016 (Table 1).
Resistance against the antiviral drugs occurs through mutations in the viral genome. Resistance to NI is caused by single point mu‐
tations in the neuraminidase (NA) gene. Substitutions in several codons have been identified, in vitro, to cause different levels of resistance against the different drugs.2 The H275Y mutation (N1 numbering) reduces susceptibility of H1N1 influenza virus to os‐
eltamivir by more than 400‐fold and also reduces susceptibility to peramivir, but does not cause resistance to zanamivir in vitro.3 Antiviral‐resistant viruses do emerge sporadically. It was initially believed that antiviral resistance mutations would be generally un‐
favourable for virus infectivity and transmission. However, in 2007, Norway reported unprecedentedly high proportions of oseltamivir resistance in former seasonal H1N1 viruses, due to the H275Y sub‐
stitution in the NA gene. Obviously, these viruses had not suffered a loss in fitness and appeared in many other countries at the same time. Within 1 year, the resistant virus had become the predomi‐
nant H1N1 strain globally.4‐6 The first case of resistant pandemic H1N1 virus was reported early in the 2009 pandemic in Denmark.7‐9 Local clusters/incidences of oseltamivir‐resistant H1N1 viruses have been reported from Hokkaido, Japan,10 Pennsylvania, United States and Australia.11,12 It has been shown that H1N1 viruses pos‐
sessing the NA H275Y amino acid substitution are able to replicate and transmit as efficiently as normal wild‐type viruses, provided TABLE 1 Oseltamivir‐resistant cases in Norway in the 2015‐16 season CaseIsolateCountyRegionSampling dateAgeSexStatusAntiv. treat.aOutcomeIC50 Oselt.IC50 Zanam.SampleOselt. Res. aZanam. Res. bRes. Mut.Acc_no_HAAcc_no_NA 1A/Norway/2914/2015Aust‐AgderSouth14.12.20154MONU7233.5ThroatHRINI275YEPI695299EPI700046 2A/Norway/411/2016ØstfoldEast19.01.201630MOUUNDNDNasopharynxAAHRIAANI275YEPI759009EPI759182 3A/Norway/541/2016HordalandWest25.01.201650FOUUNDNDNasopharynxAAHRIAANI275YEPI759014EPI759183 4A/Norway/1476/2016HedmarkEast02.03.201657FOUU3010.6NasopharynxHRINI275YEPI759038EPI759188 5A/Norway/1828/2016BuskerudEast04.03.201666FHN3891.0UHRINI275YEPI759045EPI759193 6A/Norway/1759‐2/2016Nord‐TrøndelagMiddle09.03.201657MHYI + DNDNDBronchialAAHRIAANI275YEPI759044EPI759191 6A/Norway/1759‐3/2016Nord‐TrøndelagMiddle09.03.201657MHYI + DNDNDNasopharynxAAHRIAANI275HY (48%)No sequenceEPI759192 7A/Norway/2036/2016HedmarkEast10.03.201653FHY5101.9UHRINI275YEPI759048EPI759194 8A/Norway/2114/2016BuskerudEast18.03.201651MONUUAAHRIAANI275YEPI759049EPI759195 9A/Norway/2298/2016BuskerudEast21.03.201678MHN2460.7NasopharynxHRINI275YEPI759051EPI759196 10A/Norway/2404/2016VestfoldEast21.03.201651FONUNDNDNasopharynxAAHRIAANI275YEPI759053EPI759197 AAHRI, amino acid substitution previously associated with highly reduced inhibition; AANI, amino acid substitution previously associated with normal inhibition; D, dead; F, female; H, histidine; H, hospitalised; HRI, highly reduced inhibition (>100‐fold increase in IC50); I, intensive care; M, male; N, no; ND, not done; NI, normal inhibition (<10‐fold increase in IC50); O, outpatient; U, unknown; Y, tyrosine; Y, yes. aAntiviral drugs are very seldom used in Norway. Antiviral treatment (oseltamivir) is mainly given to patients with severe respiratory disease in critical care. bWild‐type IC50 median for oseltamivir‐sensitive H1N1 virus 0.9, zanamivir‐sensitive virus 0.5.
that mutations are present in other positions that make up for the prior disadvantage of the H275Y substitution.13,14
Here, we report increased incidences of H1N1 viruses with highly reduced inhibition (HRI) by oseltamivir, possessing the H275Y NA substitution, during the 2015/16 influenza season in Norway.
2 | METHODS
Influenza viruses were obtained as part of the national surveillance system for influenza in Norway. Medical microbiology laboratories (non‐sentinel), representing all 19 counties, submit a selection of samples PCR positive for each influenza virus type to the NIC every week. General practitioners enrolled in the national influenza sur‐
veillance programme (sentinel n = ~70) collect samples from patients with influenza‐like illness and send them for diagnostic testing at the NIC. The NIC receives a nearly even distribution of samples from outpatients (both non‐sentinel and sentinel) and hospitalised pa‐
tients (non‐sentinel).
Samples were tested for antiviral resistance both genetically and phenotypically. Nucleic acid (200 µL) was extracted from clinical sam‐
ples using the MagNA Pure 96 DNA and Viral RNA Small Volume Kit (Roche diagnostics, Basel, Switzerland), typed4 and H1 subtyped15 by real‐time RT‐PCR on RotorGene cycler system (Corbett/QIAGEN, Hilden, Germany). H1N1 viruses were screened for the H275Y mu‐
tation by pyrosequencing16 on the PyroMark Q96 ID (QIAGEN) with primers: sw‐N1‐F780B GGGAAAGATAGTCAAATCAGTCGA, sw‐N1‐R1273E (5′‐biotin) CAACCCAGAAGCAAGGTCTTAT, sw‐N1‐
F804Bseq AATGAATGCMCCTAATT. The NA gene was also fully or partially sequenced by Sanger sequencing on Applied Biosystems 3500xL Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA) (PCR and sequencing primers available upon request). Viruses for phenotypic resistance analysis were isolated/propagated in MDCK cells, one to two passages.17 The susceptibility of virus isolates to os‐
eltamivir and zanamivir was measured by a neuraminidase inhibition assay, applying 20‐(4‐methylumbelliferyl)‐a‐D‐N‐acetylneuraminic acid (MUNANA) substrate18 to determine the concentration of drug that inhibits the neuraminidase activity by 50% (IC50).19 Whereas functional drug susceptibility was ascertained on MDCK grown virus, all genotypic testing was performed on original clinical material.
H1 viruses were characterised as oseltamivir‐resistant by the measurable (ie >10% of NA‐encoding RNA) presence of the H275Y substitution in the NA protein and/or with elevated neuraminidase inhibitory IC50 values compared to the mean IC50 of susceptible samples in current and previous seasons. An isolate with a 10‐ to 100‐fold increase in IC50 was classified as having “reduced inhibi‐
tion” (RI) and with more than 100‐fold increase in IC50 as “highly re‐
duced inhibition” (HRI). Viruses that could not be propagated for NA susceptibility studies were characterised as “amino acid substitution previously associated with highly reduced inhibition” (AAHRI) by the presence of the H275Y substitution. Nucleotide sequences were fur‐
ther analysed by BioNumerics (Applied Maths, Sint‐Martens‐Latem,
Belgium), BioEdit20 and MEGA 6 software.21 Phylogenetic trees were constructed with the neighbor‐joining method, using Kimura 2‐parameter pairwise distances. Nucleotide cluster analysis was performed with maximum parsimony trees. Sequences were sub‐
mitted timely to the EpiFlu database hosted by the Global Initiative on Sharing All Influenza Data (GISAID). The accession numbers of resistant Norwegian viruses are given in Table 1. The amino acids positions are described using N1 numbering.
Antiviral sales figures were extracted from the Norwegian Drug Wholesales Statistics and the Norwegian Prescription Database (NorPD). The wholesales statistics contain complete data on all medicines sold, as packages sold and number of defined daily doses (DDD), from the wholesalers to Norwegian pharmacies, hospitals and nursing homes. We calculated courses sold per. 1000 inhab‐
itants based on population data from Statistics Norway. The pre‐
scription database receives reports from all pharmacies in Norway on prescriptions filled by outpatients registered on their unique per‐
sonal identification number.
3 | RESULTS
Influenza A viruses accounted for 69% of the influenza virus de‐
tections in the 2015‐16 season in Norway. As in most European countries that season, H1N1 was accounted for more than 90% of sentinel influenza A viruses in Norway. Activity peaked at inter‐
mediate levels in late February, weeks 5 through 8. From week 12 onwards, influenza B viruses of the Victoria/2/1987 lineage predom‐
inated until settling at low levels in early June (Figure 1). The H1N1 viruses mostly belonged to the 6B.1 clade.22 In total, 2580 samples were collected for further analysis this season (276 H3N2, 1310 H1N1 and 994 influenza B). Out of the H1N1 viruses received, 571 were from hospitalised patients and 734 were from outpatients (out of these, 75 were from the sentinel system of GPs). We performed neuraminidase susceptibility testing on 326/1310 (28%) of the H1N1 viruses, 264 of the H3N2 viruses (24%) and 69 of the influenza B viruses (7%) that were received at the NIC in the 2015/16 season.
The neuraminidase gene was sequenced either by pyro‐ or Sanger sequencing in 301 samples.
Since the H1N1 emergence during the 2009 pandemic and until the 2015/16 season, only one Norwegian virus, (A/
Norway/2227/2015 H1N1pdm09), collected in May 2015, had been found resistant to oseltamivir. The virus, possessing the H275Y sub‐
stitution, was from an outpatient from south‐east of Norway, with no history of antiviral treatment or travel abroad. The first resistant H1N1 virus in the 2015/16 influenza season (A/Norway/2914/2015) was detected in December 2015 (Table 1). The sample was collected as part of the surveillance system and was from an outpatient child, with no exposure to antiviral drugs or travel history. By the end of March 2016, the proportion of samples with antiviral resistance to oseltamivir (275Y mutation) had increased to 3% of the tested H1N1 samples. In total, 10 out of the 326 H1N1 samples tested were found
to be oseltamivir‐resistant (Table 1), all belonging to the HA genetic clade 6B.1. Six of these ten resistant cases were sampled from out‐
patients and four cases were from hospitalised patients. Seven out of these ten cases were sampled in March 2016. The six resistant samples from outpatients were from different parts of southern Norway (Figure 2) and were detected from week 51 in 2015 through week 12 in 2016. Three of the outpatients were known not to have been treated with antivirals. Two of the four hospitalised cases had received antiviral treatment. Hospitalised resistant cases were, as the outpatient samples, from different parts of southern Norway, but all were sampled in March 2016 (Figure 2).
Six resistant viruses from different geographic regions, both from hospitalised and outpatients spanning from week 3 through week 12 of 2016, clustered together phylogenetically in both the HA and NA genes (Figures 3 and 4) and were closely related to the first resistant case from December. This cluster of viruses was characterised by amino acid substitution N370S in the HA stalk region and a signature silent nucleotide mutation to guanine at position 711 in the HA gene.
In NA, these viruses were characterised by the amino acid substi‐
tution T48I, not found in other resistant cases or other cases from Norway and very few globally; only one single sample in GISAID EpiFlu, besides the Norwegian strains” possessed the T48I substitu‐
tion in NA, but this sample lacked the H275Y substitution. It cannot be excluded, however, that a less than 50% presence of the substi‐
tution may have been overlooked in sequencing. Therefore, similar viruses have not been reported from other countries, which could imply that the virus has not spread further. This T48I substitution
was not found in the first case of resistance (A/Norway/2914/2015), but this case had the signature nucleotide mutations uracil at posi‐
tions 39 and 573 in common with the six later cases.
The hospitalised patient with sample A/Norway/1759/2016 (Table 1) developed resistance during treatment with oseltamivir (Table 1) but died shortly after. The virus in the initial bronchoalve‐
olar lavage (BAL) sample taken 1 March (A/Norway/1759‐1/2016) was oseltamivir sensitive, carrying histidine in position 275. A naso‐
pharynx sample (A/Norway/1759‐3/2016) from 9 March, following oseltamivir treatment, indicated development of resistance by 48%
Y in position 275. Virus in a BAL sample from the same patient (A/
Norway/1759‐2/2016) taken the same day was resistant to osel‐
tamivir possessing the H275Y substitution (70%).
Another hospitalised case with resistant virus (A/
Norway/2298/2016) (Table 1), who was treated with oseltamivir, groups phylogenetically together with the resistant virus from an outpatient (A/Norway/2114/2016) in both HA and NA genes (Figure 2). These viruses share one signature nucleotide mutation uracil at position 451, not found in any other Norwegian H1 vi‐
ruses. Both persons (age > 50) lived in the same neighbourhood.
The outpatient was sampled 3 days before the hospitalised patient (Table 1).
The phenotypic resistance analysis of viruses that we were able to propagate supported the genetic analysis of oseltamivir‐
resistant viruses, with a 1000‐fold increase in IC50 confirming highly reduced inhibition by oseltamivir and normal inhibition by zanamivir (Table 1).
F I G U R E 1 Laboratory detections, Norway, 2015‐16. Weekly numbers of the different influenza viruses are displayed as stacked bars, and influenza virus positivity rates of all laboratory testing are shown as line graphs
F I G U R E 2 Geographic localisation of oseltamivir‐resistant cases in Norway in the 2015/16 season. Oseltamivir‐resistant viruses from outpatient (red) and hospitalised persons (green) at different time periods (wk) and locations in the southern part of Norway in the 2015‐16 season. Numbers indicate week of sampling
Out-patient Hospitalised Numbers indicate week sampled
51 4
9 12 11 10
12 10
11
4
Antiviral use in Norway is low with sales of one courses/1000 inhabitants during 2016 (Table 2). Much higher sales were recorded during the 2009 H1N1 pandemic (Table 2). Hospitals represent ap‐
proximately 31% of dispensed doses while prescriptions stand for 48% and nursery homes, GPs or other institutions for 22% measured in DDDs (based on wholesale numbers from 2015). The consump‐
tion is higher in adults than in elderly and children.
4 | DISCUSSION
An unusually high percentage of antiviral resistance to oseltamivir was detected in influenza H1N1 viruses from Norway during the 2015‐16 season. The ten H1N1pdm09 oseltamivir‐resistant cases (3%) included both outpatients and hospitalised patients. The ge‐
netic analysis suggests that resistant virus emerged independently on several occasions and that there was some spread of oseltami‐
vir‐resistant influenza A(H1N1) 6B.1 viruses in the community. The first case was detected in December in an outpatient. During the season, six of the resistant viruses formed a genetic cluster with resistant viruses from different geographic locations in Norway, spanning from week 3 to week 12. Five of these cases had no an‐
tiviral treatment and four of the cases were outpatients. The sin‐
gle patient undergoing treatment was sampled second last of the samples in the cluster; thus, it is likely that the resistance mutation
was present at infection and did not arise as a consequence of treatment of that patient. It is therefore most likely that the resist‐
ant viruses from this cluster were able to persist in the community at least from late January and until the very end of the season.
The signature NA substitution at position 48 (T48I) in NA of this cluster of viruses is located in the unstructured linker region (resi‐
due 35‐82) which connects the membrane anchor to the catalytic neuraminidase domain (residues 83‐469).23 The unique substitu‐
tion in HA, N370S, is located in the stalk region of HA. The effect on virus transmission or infectivity caused by these substitutions is unknown.
Two other resistant viruses clustered together in both the HA and NA genes. The two viruses were found in one hospitalised pa‐
tient with oseltamivir treatment and one outpatient from the same neighbourhood. The outpatient was sampled 3 days before the hos‐
pitalised patient. It is therefore not unlikely that the hospitalised pa‐
tient was infected with an already resistant virus before treated with oseltamivir.
The last case of resistance was a result of antiviral treatment and was genetically distinguishable from the first case and the two other clusters of resistant viruses that season.
All Norwegian H1N1 viruses characterised possessed the V241I and N369K substitutions in NA, including the resistant viruses.
These mutations are known to increase replication and transmission fitness14 and were reported during a widespread cluster of H275Y
F I G U R E 3 HA and NA gene cluster analysis of H1N1 virus in the 2015/16 season in Norway. HA and NA genetic diversity (nucleotide) of oseltamivir‐
resistant Norwegian viruses from outpatients (red), hospitalised (green) patients and non‐resistant cases (open circles) with reference virus A/
California/7/09(H1N1)pdm09. Genetic groups are indicated in the H1 cluster, and key amino acid substitutions defining the community‐spread oseltamivir‐resistant cluster are given. Cluster analysis was constructed with BioNumerics, and basic maximum parsimony tree was applied as network creation method
N1 H1
6B.2
6B.1 6B
H275Y Hospitalised H275Y Outpatient
H275 Reference A/California/7/09
N370S
T48I
F I G U R E 4 Phylogenetic reconstruction of Norwegian 2015‐16 A/H1N1pdm09 HA (A) and NA (B) genes. Reference viruses are in bold, vaccine strain 2015‐16 is marked in red bold italic and root is underlined. Aligned partial HA gene sequences (1010 bases) (A) and NA gene sequences (945 bases) (B) were subjected to phylogenetic analysis using neighbor‐joining of Kimura‐corrected genetic distances. Bootstrap values above 70% out of 500 resamplings are shown. Norwegian viruses from this season are named as “local ID_Isolate name_week.” Key amino acid differences to the reference A/California/07/2009 are indicated on key branch nodes. Oseltamivir‐resistant viruses from Norway in the 2015‐16 season are underlined. , Hospitalised; , Treated with oseltamivir. Genetic H1N1 groups are indicated on the side of the tree
25163566 A/Norway/3566/2016 20 25163682 A/Norway/3682/2016 21 25163592 A/Norway/3592/2016 21 25160244 A/Norway/244/2016 2 25160139 A/Norway/139/2016 1 25153090 A/Norway/3090/2015 53 25161471 A/Norway/1471/2016 9 25152658 A/Norway/2658/2015 45 25160399 A/Norway/399/2016 3
n = 16 n = 6
25152711 A/Norway/2711/2015 47 25160510 A/Norway/510/2016 4 25152919 A/Norway/2919/2015 50 25152776 A/Norway/2776/2015 49 25162150 A/Norway/2150/2016 12 25160357 A/Norway/357/2016 3
25162298 A/Norway/2298/2016 12 25162114 A/Norway/2114/2016 11 25152734 A/Norway/2734/2015 46
25160151 A/Norway/151/2016 2 25160146 A/Norway/146/2016 1 25152895 A/Norway/2895/2015 50 25160150 A/Norway/150/2016 2
25152685 A/Norway/2685/2015 46 25152680 A/Norway/2680/2015 46 25152687 A/Norway/2687/2015 46 25152651 A/Norway/2651/2015 45 25160989 A/Norway/989/2016 7
25164046 A/Norway/4046/2016 25 25164091 A/Norway/4091/2016 33 25162360 A/Norway/2360/2016 13
25163790 22 25160589 A/Norway/589/2016 5 25160272 A/Norway/272/2016 2
25160613 A/Norway/613/2016 4 25162628 13
25160782 A/Norway/782/2016 6 25161886 A/Norway/1886/2016 11
25160209 A/Norway/209/2016 1 25161696 A/Norway/1696/2016 10 25160991 A/Norway/991/2016 7
25163455 A/Norway/3455/2016 18 25163452 A/Norway/3452/2016 18 25163537 19
25160912 A/Norway/912/2016 5 25152631 A/Norway/2631/2015 44 25160831 A/Norway/831/2016 5 25160460 A/Norway/460/2016 3 25160998 A/Norway/998/2016 6 25160689 A/Norway/689/2016 3 25160633 A/Norway/633/2016 4
25153096 A/Norway/3096/2015 53 25153038 A/Norway/3038/2015 53 25160131 A/Norway/131/2016 2 25161006 A/Norway/1006/2016 6 25161486 A/Norway/1486/2016 7 25152650 A/Norway/2650/2015 45
25162034 A/Norway/2034/2016 10 25152914 A/Norway/2914/2015 51 25160358 A/Norway/358/2016 2
25161438 A/Norway/1438/2016 9 25161437 A/Norway/1437/2016 8 25161270 A/Norway/1270/2016 8 25160411 A/Norway/411/2016 3 25162036 A/Norway/2036/2016 10 25162404 A/Norway/2404/2016 12 25160541 A/Norway/541/2016 4
25161476 A/Norway/1476/2016 9 25161828 A/Norway/1828/2016 9 A/Jordan/20241/2015 EPI ISL 179256
25152672 A/Norway/2672/2015 45 A/Hong Kong/12243/2015 EPI ISL 193119 A/Bangladesh/3003/2015 EPI ISL 192137 A/Mauritius/I-463/2015 EPI ISL 193121 25152575 A/Norway/2575/2015 30 n = 21
A/Norway/1690/2015 EPI ISL 191859 25161177 A/Norway/1177/2016 7 A/Madagascar/1566/2015 EPI ISL 190949 A/Cameroon/15V-3814/2015 EPI ISL 191830 A/South Africa/R2977/2015 EPI ISL 193140 A/Guyane/1759/2015 EPI ISL 191739
A/St-Petersburg/122/2015 EPI ISL 191868 A/Slovenia/1314/15 EPI ISL 193128
A/IIV-Moscow/94/2015 EPI ISL 191847 A/South Africa/R3723/2015 EPI ISL 193144 A/Bangladesh/01/2015 EPI ISL 192136
A/IIV-Moscow/93/2015 EPI ISL 191846 25152592 A/Norway/2592/201535 25152595 A/Norway/2595/201538
25152660 A/Norway/2660/2015 45 25152659 A/Norway/2659/2015 45 25152658 A/Norway/2658/2015 45 (2)
25153004 A/Norway/3004/2015 51 25160141 A/Norway/141/2016 1
25160116 A/Norway/116/2016 1 A/South Africa/3626/2013 EPI ISL 145447
A/Dakar/04/2014 EPI ISL 165503
A/Ghana/DILI-14-0620/2014 EPI ISL 174948 A/St.Petersburg/27/2011 EPI ISL 90760
A/Hong Kong/5659/2012 EPI ISL 127652 A/Norway/120/2013 EPI ISL 134121 A/St.Petersburg/100/2011 EPI ISL 90954 A/Czech Republic/32/2011 EPI ISL 90718 A/Astrakhan/1/2011 EPI ISL 90787 A/Lviv/N6/2009 EPI ISL 62012
A/Christchurch/16/2010 EPI ISL 79239 A/Hong Kong/3934/2011 EPI ISL 93746
A/Dakar/20/2012 EPI ISL 134399 A/Bayern/69/2009 EPI ISL 73686
A/California/07/2009
99 76 99 93
80 87
70 86
94 90
86 88
96 83
87
95
0.002
A215G
R113K D127E K374Q
6B.2 6B 6B.1
S84N S162N I216T
V152T V173I K163Q
A256T K283E I321V
Includes A/Norway/1759-2/2016
N370S
N370S V234I (A)
25152631 A/Norway/2631/2015 44 25153028 A/Norway/3028/2015 52 25160171 A/N /171/2016 1 25160171 A/Norway/171/2016 1 25153026 A/Norway/3026/2015 51
25164046 A/Norway/4046/2016 25 25160150 A/Norway/150/2016 2
25152674 A/Norway/2674/2015 45 25161728 A/Norway/1728/2016 10
25152650 A/Norway/2650/2015 45 25160151 A/Norway/151/2016 2 25152626 A/Norway/2626/2015 43
25162114 A/Norway/2114/2016 11
H275Y
25162298 A/Norway/2298/2016 12 25152914 A/Norway/2914/2015 51
25160411 A/Norway/411/2016 3 25160541 A/Norway/541/2016 4 25161828 A/Norway/1828/2016 9 25162036 A/Norway/2036/2016 10 25161476 A/Norway/1476/2016 9
25162404 A/Norway/2404/2016 12 25161270 A/Norway/1270/2016 8 25162625 A/Norway/2625/2016 10
88
V13I
6B.1
T48I
H275Y
N73K
Samples
V34L S44I
25162625 A/Norway/2625/2016 10 25162626 10
25162627 9
25160209 A/Norway/209/2016 1 25152625 A/Norway/2625/2015 43 A/Hong Kong/12243/2015 EPI ISL 193119 A/Mauritius/I-463/2015 EPI ISL 193121
A/Bangladesh/3003/2015 EPI ISL 192137 25152624 A/Norway/2624/2015 43 25152646 A/Norway/2646/2015 45 91
88
89
Q45R A86V V264I
N270K I34V I314M
from samep patient, dead
6B
25152647 A/Norway/2647/2015 45 25160178 A/Norway/178/2016 1
25152633 A/Norway/2633/2015 44 25152634 A/Norway/2634/2015 44 25160174 A/Norway/174/2016 1 25153004 A/Norway/3004/2015 51 A/Jordan/20241/2015 EPI ISL 179256
A/IIV-Moscow/93/2015 EPI ISL 191846 A/Bangladesh/01/2015 EPI ISL 192136 A/Norway/1690/2015 EPI ISL 191859 84
81
94 90
I13V V34I
V67I
6B.2
A/Norway/1690/2015 EPI ISL 191859 A/Guyane/1759/2015 EPI ISL 191739 A/Cameroon/15V-3814/2015 EPI ISL 191830 A/IIV-Moscow/94/2015 EPI ISL 191847 A/Madagascar/1566/2015 EPI ISL 190949
A/St-Petersburg/122/2015 EPI ISL 191868 A/Slovenia/1314/15 EPI ISL 193128 A/South Africa/R2977/2015 EPI ISL 193140
A/South Africa/R3723/2015 EPI ISL 193144 A/South Africa/3626/2013 EPI ISL 145447
98
84 94
79
97 V67I
A/Dakar/04/2014 EPI ISL 165503
A/Ghana/DILI-14-0620/2014 EPI ISL 174948 A/St.Petersburg/100/2011 EPI ISL 90954
A/Astrakhan/1/2011 EPI ISL 90787 A/St.Petersburg/27/2011 EPI ISL 90760
A/Hong Kong/5659/2012 EPI ISL 127652 A/Norway/120/2013 EPI ISL 134121
A/Christchurch/16/2010 EPI ISL 79239 A/Lviv/N6/2009 EPI ISL 62012
A/Czech Republic/32/2011 EPI ISL 90718 70
76
80 70
A/Dakar/20/2012 EPI ISL 134399 A/Bayern/69/2009 EPI ISL 73686
A/California/07/2009 0.002
(B)
F I G U R E 4
mutant H1 viruses in Australia in 2011.12 All Norwegian H1N1 vi‐
ruses had lost the same glycosylation site in NA as reported in the Hokkaido cluster, due to the substitution N386K.10 These three sub‐
stitutions are now present in the vast majority of circulating H1N1 viruses.
The proportion of oseltamivir‐resistant viruses carrying the H275Y substitution was 3%, while the overall frequency in Europe the same season was 0.87% (27 viruses),24 with 10 out of these 27 resistant H1 cases being of Norwegian origin. The global overall frequency for viruses with reduced inhibition (RI) or highly reduced inhibition (HRI) by neuraminidase inhibition (NAI) assay was 0.5% in 2014/1525 and 1.8% in 2015/16.26 The consumption of influenza an‐
tivirals in Norway is generally very low (Table 2) and is not believed to have contributed to increased prevalence of resistance. Studies suggest that approximately 64% of oseltamivir‐resistant cases de‐
tected have arisen in immunosuppressed patients and occurred after oseltamivir treatment, with only 12% of resistance developing with‐
out drug use27,28; however, antiviral resistance in untreated patients is largely understudied. Development of resistance to oseltamivir during treatment occurred more among seasonal influenza A(H1N1) virus infections (27%) compared with seasonal influenza A (H3N2) (3%) or B (0%) viruses.29 In Norway 2016, most (6 out of 10) os‐
eltamivir‐resistant H1N1 cases were outpatients not likely related to antiviral drug treatment. Community cases will only sporadically be picked up if antiviral resistance testing is mainly conducted on immunocompromised patients or hospitalised patient on antivi‐
ral treatment. Most resistant cases during the 2015‐16 season in Norway occurred at the end of the season in March. By the end of March, very few H1 cases were detected and by week 12 influenza B dominated until season ended. The following season (2016‐17) was dominated by H3N2 viruses in Norway and Europe with very few H1N1 viruses circulating, and the 2017‐18 season was dominated by influenza B, also with few H1N1 viruses. The frequency of antiviral‐
resistant H1N1 viruses in Europe increased from 0.4% in 2014/15
to 0.9% in 2015/16 to 1.9% both 2016/17 and 2017/18 (Flu News Europe). The overall prevalence of resistant influenza strains was between 0.3% and 0.9%.
Antiviral resistance testing on community viruses should be a priority, especially in the following seasons dominated by H1N1 vi‐
ruses. As mentioned, there have previously been other incidences of resistant H1N1 community clusters as in Australia in 201112 and in Hokkaido, Japan, in 2013‐14.10,30 None of the clusters persisted until the subsequent season, as the mutant resistant viruses faded out in spring and other, imported, H1N1 viruses founded the next‐season circulating strains in autumn. Our results emphasise the importance of surveillance of antiviral resistance, not only in immunocompromised patients or during treatment; community surveillance is of equal or higher priority. It is worrying that we found this high frequency of re‐
sistance in Norway and this report will hopefully increase the aware‐
ness of resistant viruses circulating in the community. Many countries have to rely solely on oseltamivir as antiviral treatment; zanamivir is no longer available on the Norwegian market due to low sales, there‐
fore options for alternative antivirals are needed.
ACKNOWLEDGEMENTS
We thank the skilful technical assistance of Marie Madsen Paulsen, Valentina Morales Johansen, Remilyn Vicenta R. Ramos‐Ocao, Marianne Morken, Anne Maria Lund and Torstein Aune. We also grate‐
fully acknowledge the contributions of the Oslo University Hospital and the microbiological laboratories and sentinel general practitioners enrolled in the Norwegian influenza surveillance system, providing clin‐
ical samples and reports every week to the NIC in Norway. A number of sequences were accessed in the GISAID database EpiFlu, and we grate‐
fully acknowledge the contributions of all the people and institutions that have been developing and maintaining this sharing mechanism, as well as the authors, originating and submitting laboratories of the se‐
quence data that we have used.
TA B L E 2 Sales of influenza antivirals, Norway, 2009‐2016
Year
Wholesales statisticsa Prescriptions
Number of courses sold
Total courses sold per 1000 inhabitants
Number of courses sold
Total courses sold per 1000 inhabitants
Oseltamivir Zanamivir Total Oseltamivir Zanamivir Total
2009 811 971 76 215 888 186 185.07 345 015 2986 348 001 72.51
2010b −406 549 −67 804 −474 353 −97.64 4676 46 4722 0.97
2011 6471 −38 6433 1.31 3205 50 3255 0.66
2012 3489 −87 3402 0.68 2234 38 2272 0.46
2013 10 377 61 10 438 2.07 4552 94 4646 0.92
2014 3131 21 3152 0.62 1259 21 1280 0.25
2015 3678 66 3744 0.72 1699 59 1758 0.34
2016 5459 15 5474 1.05 2562 27 2589 0.50
aWholesales statistics represent sales from wholesalers to pharmacies, hospitals and nursing homes. Prescriptions: Sales from the Norwegian Prescription Database (NorPD) are included in the wholesales statistics.
bThe negative numbers in 2010 are a result of return of unused medicines to the wholesales after stockpiling due to the 2009 pandemic. This means that at least 50% of the courses sold in 2009 were not used. It is not possible to separate the sales of new packages in 2010 from the returns from 2009.
ORCID
Karoline Bragstad https://orcid.org/0000‐0003‐0943‐0165
REFERENCES
1. Zaraket H, Saito R. Japanese surveillance systems and treatment for influenza. Curr Treat Options Infect Dis. 2016;8(4):311‐328.
2. Nguyen HT, Fry AM, Gubareva LV. Neuraminidase inhibitor resis‐
tance in influenza viruses and laboratory testing methods. Antivir Ther. 2012;17(1 Pt B):159‐173.
3. Mishin VP, Hayden FG, Gubareva LV. Susceptibilities of antivi‐
ral‐resistant influenza viruses to novel neuraminidase inhibitors.
Antimicrob Agents Chemother. 2005;49(11):4515‐4520.
4. Hauge SH, Blix HS, Borgen K, Hungnes O, Dudman SG, Aavitsland P.
Oseltamivir‐resistant influenza viruses A (H1N1), Norway, 2007‐08.
Emerg Infect Dis. 2009;15(2):155‐162.
5. Lackenby A, Hungnes O, Dudman SG, et al. Emergence of resis‐
tance to oseltamivir among influenza A(H1N1) viruses in Europe.
Euro Surveill. 2008;13(5):8026.
6. Ciancio BC, Meerhoff TJ, Kramarz P, et al. Oseltamivir‐resis‐
tant influenza A(H1N1) viruses detected in Europe during season 2007‐8 had epidemiologic and clinical characteristics sim‐
ilar to co‐circulating susceptible A(H1N1) viruses. Euro Surveill.
2009;14(46):19412.
7. Fordyce SL, Bragstad K, Pedersen SS, et al. Genetic diversity among pandemic 2009 influenza viruses isolated from a transmission chain. Virol J. 2013;10:116.
8. Duan S, Boltz DA, Seiler P, et al. Oseltamivir‐resistant pandemic H1N1/2009 influenza virus possesses lower transmissibility and fitness in ferrets. PLoS Pathog. 2010;6(7):e1001022.
9. Duan S, Boltz DA, Seiler P, et al. Competitive transmissibility and fitness of oseltamivirsensitive and resistant pandemic influenza H1N1 viruses in ferrets. Influenza Other Respir Viruses. 2011;5(Suppl 1):79‐82.
10. Takashita E, Kiso M, Fujisaki S, et al. Characterization of a large clus‐
ter of influenza A(H1N1)pdm09 viruses cross‐resistant to oseltami‐
vir and peramivir during the 2013‐2014 influenza season in Japan.
Antimicrob Agents Chemother. 2015;59(5):2607‐2617.
11. Hurt AC, Hardie K, Wilson NJ, et al. Community transmission of oseltamivir‐resistant A(H1N1)pdm09 influenza. N Engl J Med.
2011;365(26):2541‐2542.
12. Hurt AC, Hardie K, Wilson NJ, et al. Characteristics of a widespread community cluster of H275Y oseltamivir‐resistant A(H1N1)pdm09 influenza in Australia. J Infect Dis. 2012;206(2):148‐157.
13. Abed Y, Pizzorno A, Bouhy X, Boivin G. Permissive changes in the neuraminidase play a dominant role in improving the viral fitness of oseltamivir‐resistant seasonal influenza A(H1N1) strains. Antiviral Res. 2015;114:57‐61.
14. Butler J, Hooper KA, Petrie S, et al. Estimating the fitness ad‐
vantage conferred by permissive neuraminidase mutations in re‐
cent oseltamivir‐resistant A(H1N1)pdm09 influenza viruses. PLoS Pathog. 2014;10(4):e1004065.
15. Schulze M, Nitsche A, Schweiger B, Biere B. Diagnostic approach for the differentiation of the pandemic influenza A(H1N1)v virus from recent human influenza viruses by real‐time PCR. PLoS ONE.
2010;5(4):e9966.
16. CDC. 2009. http://www.who.int/csr/resources/publications/
swineflu/NA_DetailedPyrosequencing_20090513.pdf?ua=1.
Accessed May 13, 2009
17. Network WGIS. Manual for the Laboratory Diagnosis and Virological Surveillance of Influenza. Geneva: World Health Organization;
2011.
18. Lackenby A. Influenza Munana Neuraminidase Activity And Inhibition Assay (Fluorescent IC50 ASSAY) V‐6815/01‐10]. https://
isirv.org/site/images/stories/avg_documents/Methodology/mu‐
nana_ic50_sop_for_external.pdf
19. Wetherall NT, Trivedi T, Zeller J, et al. Evaluation of neuraminidase enzyme assays using different substrates to measure susceptibil‐
ity of influenza virus clinical isolates to neuraminidase inhibitors:
report of the neuraminidase inhibitor susceptibility network. J Clin Microbiol. 2003;41(2):742‐750.
20. Hall TA. BioEdit: a user‐friendly biological sequence alignment ed‐
itor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95‐98.
21. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, MEGA6, . Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol.
2013;30(12):2725‐2729.
22. Broberg E, Melidou A, Prosenc K, Bragstad K, Hungnes O, WHO European Region and the European Influenza Surveillance Network members of the reporting countries. Predominance of influenza A(H1N1)pdm09 virus genetic subclade 6B.1 and influenza B/
Victoria lineage viruses at the start of the 2015/16 influenza season in Europe. Euro Surveill. 2016;21(13):30184.
23. Maurer‐Stroh S, Ma J, Lee RT, Sirota FL, Eisenhaber F. Mapping the sequence mutations of the 2009 H1N1 influenza A virus neur‐
aminidase relative to drug and antibody binding sites. Biol Direct.
2009;4:18. discussion 18.
24. ECDC. Influenza virus characterisation, Summary Europe, September 2016; 2016.
25. Hurt AC, Besselaar TG, Daniels RS, et al. Global update on the sus‐
ceptibility of human influenza viruses to neuraminidase inhibitors, 2014‐2015. Antiviral Res. 2016;132:178‐185.
26. Gubareva LV, Besselaar TG, Daniels RS, et al. Global update on the susceptibility of human influenza viruses to neuraminidase inhibi‐
tors, 2015‐2016. Antiviral Res. 2017;146:12‐20.
27. Leung TW, Tai AL, Cheng PK, Kong MS, Lim W. Detection of an os‐
eltamivir‐resistant pandemic influenza A/H1N1 virus in Hong Kong.
J Clin Virol. 2009;46(3):298‐299.
28. Hurt AC, Chotpitayasunondh T, Cox NJ, et al. Antiviral resis‐
tance during the 2009 influenza A H1N1 pandemic: public health, laboratory, and clinical perspectives. Lancet Infect Dis.
2012;12(3):240‐248.
29. Stephenson I, Democratis J, Lackenby A, et al. Neuraminidase in‐
hibitor resistance after oseltamivir treatment of acute influenza A and B in children. Clin Infect Dis. 2009;48(4):389‐396.
30. Takashita E, Ejima M, Itoh R, et al. A community cluster of influenza A(H1N1)pdm09 virus exhibiting cross‐resistance to oseltamivir and peramivir in Japan, November to December 2013. Euro Surveill.
2014;19(1):20666.
How to cite this article: Bragstad K, Hungnes O, Litleskare I, Nyrerød HC, Dorenberg DH, Hauge SH. Community spread and late season increased incidence of oseltamivir‐resistant influenza A(H1N1) viruses in Norway 2016. Influenza Other Respi Viruses. 2019;00:1–10. https://doi.org/10.1111/
irv.12637
